🔥 Popular | Latest

Very planned Parenthood: The Turkey Story So it's 2001, and my family drives from fu California and like three blizzards to get to Ohio for into a nursing home and it's their last holiday in that house. So its a bit bittersweet but ultimately a good thing. Since it's their last holiday there, the family pulls out all the stops when it comes to dinner, all the Russian desserts come out, as does the Lethal Bacon Mashed Potatoes and the horrible candied yams with the mini marshmallows dish because not all expressions of love are even if they are si In the spirit of going alout, Uncle Bobby smokes a Turkey Uncle Bobby started cooking as a boy foil-wrapped potatoes into a campfire and has been ad- dicted since, and now has a hand-made smokehouse in the backyard where he makes various cured meats and other delights. He seasons the turkey in the traditional manner, but he and grandpa have a shared passion for SO Game Hen seasoned that way, for them. Then Bobby has a Brilliant Idea. He realizes that he can stuff the turkey (once it has been smoked) with regular stuffing, and there is still plenty of room for him to put the game hen inside THAT, and stuff the game hen be- cuase why not? He confers with Mom, and she explains how to cut open the turkey so there's dramatic reveal as the stuffing and game hen come out. It's Genius. Except, of course, that my Aunt Sue is attending, Uncle Cliff s after her So the day of the dinner, tensions are running a bit high, between the marathon cooking, the kids al being trapped indoors due to aforementioned blizzards, and Uncle Cliff deciding that the best way to amuse himself is by hiding from the adults in the basement, getting drunk and rambling about how various ethic groups were destroying America. Being that I had close Muslim friends that were leaving the country becuase of 9/11, 1 was near tears from this nonsense and ready to n roughly five times my size. Sue, for some reason, keeps coming down and defending him, or telling us we're rotten children for 'attacking him, becuase she Must Stand By Her Man, even if her man is a hefty bag of dog feces with an ugly mustache My sister eventually boits upstairs to tattle and my grandfather limps down to the basement and brandishes his Hip Bone Cane, hands rock-steady in spite of the Parkinson's slowly taking over him. Firstly Cliff, It may not be my roof much longer but while you are under it you will be civil, or Ill beat your skull in. Also, dinner's ready, everyone go wash up. We go upstairs and sit down, and do the traditional "Name one thing you're thankful for as the bread gets passed around the table, and things calm down a bit. Bobby brings out the Turkey and everyone goes OOH becuase it's really pretty, them Mom carves it open so that the stuffing spills out dramatically along with the game hen and there's an appreciative gasp all around becuase it looks cool. Only Sue KEEPS gasping, in utter horror, before getting up and clasping her hands to her face ala Edvard Munch and shrieks OH MY GOD IT WAS PREGNANTI We all stare at Sue. We all look back at the fully-dressed-cooked-and-stuffed birds that in no way had any internal organs in them or ever gave live birth Then we all looked back at Sue, trying to figure out where to begin but since shed been trying to justify Cliffs behavior she was pretty much free-associating conspiracies and scandals now, and just kept going. IT WAS PREGNANT MY GOD WE'VE COMMITTED AN ABORTION WE'RE ALL GOING TO HELL FOR THIS, I'M SO SORRY JESUS She goes into full pearl-clutching gibbering horror at this point and falls back into her chair like it's a Victorian fainting couch only it's a shitty chair from the Eisenhower administration so it collapses and she slams into the floor, sobbing and kicking her feet like a toddler Everyone watched for a moment before my Mom sighs heavily and starts carving and serving the turkey while my grandmother mouths she's not coming back Cliff, reactions delayed by about six beers, finally notices his wife is on the floor and tries to pick her up, are assisted by Dad, who is saintly patient man and less immune to this jacknapery at that point. I am stuffing dinner rolls into my face to keep from laughing at this grand spectacle ICANT EAT IT, I REFUSE TO PARTAKE IN THIS BARBARISM Sue begins but Dad puts on his best Kindly Father voice (he was heavily involved with the catholic church and even considered becoming a priest before getting drafted but that's another story)and assures Sue that she need not eat, or even be in the room if she wants. She nods, placated by being the center of attention again, and Dad goes in for the kill. I wouldn't want you to go hungry. Can I make you some That would be lovely." Said Sue, joke flying over her ng 747. I recall watching my grandmot her nearly choke to death on the green beans over that, and everyone pointedly trying to avoid talking about anything poultry-related while Sue sat there and ate the most ironic scrambled eggs in the history of mankind. Shortly thereafter, Cliff threw up in the sink and they went home, and the party got underway properly, with Grandpa raising a toast to Mom and Uncle Bobby For t Turkey has been an staple since then. I'll see if I can hit Uncle Bobby up for instructions but if you decide to make it 1. you HAVE to shriek "OH MY GOD IT WAS PREGNANT when you carve it open, or it's not authentic and won't taste as good 2. Share the pictures with me, Very planned Parenthood
🔊CLICK VIDEO TURN ON THE VOLUME 🔊 MY NAME IS RICK FERRAN , AKA TANK, I am US Marine Veteran & also a communism survivor who survived 13 years under the oppressive Castro regime. I never in a million years would had imagine having to experience again what I had experience as a child growing in communism. What ANTIFA, Communists ,Socialists , BLM, Black Panthers Para Military Arms of the Democrat Party are doing to the opposition is exactly what the communists did to my family. I remember the first time the communists came to my house, students who were not old enough to know better were lead by my teachers and order my fellow peers to throw rotten eggs, rocks, bottles of urine, and feces at my house. I remember one of My neighbors try to stop the mob and he was lynched by them as I watched through the window. I was alone with my little sister and my Mother who had told us that we couldn’t go to school that morning. Thanks to my Mother sixth sense our family survived another day. My fellow Americans, this is not going to stop. It will get worse, the censorship has already begun, already groups who have tried to fight communist terrorist groups like Antifa are being persecuted and treated like criminals when it should be the other way around. I hold the democrats, the media, and the poor leadership of the Republican party responsible for such actions. The USA needs to turn around this path or we will all experience what real nightmares are made off.: FOX friends I've characterized the Antifa people and people like them as protesters, but they're not. They weren't protesting anything ..They weren't trying to change my mind or advocate for a position. They were threatening my family to get me to stop talking." -Tucker Carlson 🔊CLICK VIDEO TURN ON THE VOLUME 🔊 MY NAME IS RICK FERRAN , AKA TANK, I am US Marine Veteran & also a communism survivor who survived 13 years under the oppressive Castro regime. I never in a million years would had imagine having to experience again what I had experience as a child growing in communism. What ANTIFA, Communists ,Socialists , BLM, Black Panthers Para Military Arms of the Democrat Party are doing to the opposition is exactly what the communists did to my family. I remember the first time the communists came to my house, students who were not old enough to know better were lead by my teachers and order my fellow peers to throw rotten eggs, rocks, bottles of urine, and feces at my house. I remember one of My neighbors try to stop the mob and he was lynched by them as I watched through the window. I was alone with my little sister and my Mother who had told us that we couldn’t go to school that morning. Thanks to my Mother sixth sense our family survived another day. My fellow Americans, this is not going to stop. It will get worse, the censorship has already begun, already groups who have tried to fight communist terrorist groups like Antifa are being persecuted and treated like criminals when it should be the other way around. I hold the democrats, the media, and the poor leadership of the Republican party responsible for such actions. The USA needs to turn around this path or we will all experience what real nightmares are made off.
California Couple Arrested for Forcing Their Children to Live in Plywood Box for Almost Five Years - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ An older California couple has been arrested on child cruelty charges for forcing their three children to live in a plywood box for the last four years, the New York Post reports. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On Thursday, Mona Kirk and Daniel Panico were taken to the Morongo Basin Jail, after sheriff deputies discovered the children’s unbelievable living conditions during a property check-in Joshua Tree—which is 130 miles east of Los Angeles. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to officials, a large, rectangular box—standing approximately 4-feet high and 10-feet wide, with about 20 feet of space from end to end, was spotted near an abandoned caravan that held about 40 roaming cats and loads of trash and feces. The feces were said to be from both humans and animals. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The land surrounding the box and travel camper was filled with old junk and broken toys. A recent press release stated that the victims—ages 11, 13, and 14, were also found to have an “inadequate amount of food” in the “unsuitable and unsafe environment.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ They are now in Children and Family Services’ custody. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Kirk, 51, and Panico, 73, have a bail set at $100,000.: California Couple Arrested for Forcing Their Children to Live in Plvwood Box for Almost Five Years @balleralert California Couple Arrested for Forcing Their Children to Live in Plywood Box for Almost Five Years - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ An older California couple has been arrested on child cruelty charges for forcing their three children to live in a plywood box for the last four years, the New York Post reports. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On Thursday, Mona Kirk and Daniel Panico were taken to the Morongo Basin Jail, after sheriff deputies discovered the children’s unbelievable living conditions during a property check-in Joshua Tree—which is 130 miles east of Los Angeles. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to officials, a large, rectangular box—standing approximately 4-feet high and 10-feet wide, with about 20 feet of space from end to end, was spotted near an abandoned caravan that held about 40 roaming cats and loads of trash and feces. The feces were said to be from both humans and animals. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The land surrounding the box and travel camper was filled with old junk and broken toys. A recent press release stated that the victims—ages 11, 13, and 14, were also found to have an “inadequate amount of food” in the “unsuitable and unsafe environment.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ They are now in Children and Family Services’ custody. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Kirk, 51, and Panico, 73, have a bail set at $100,000.

California Couple Arrested for Forcing Their Children to Live in Plywood Box for Almost Five Years - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀...

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of...

loloftheday: The Professor is Not Mad… Just Disappointed: All Course Announcement Fall 2016 BIO 101 15 General Biology I Final Exam Grades Open Dismiss Hi, All I have your final exam grades 5 minutes ago Guys I really wanted to believe that Virginia Westem was not the cesspool of morons all my fellow Biology faculty told me it would be Unfortunatly your finals, which I purposely made as easy as humanly possible tanked harder than a Kardashian marriage I personally apologize for expecting the bare minimum from you as students. If you look at your grade book you will notice that you have all gotten a extra credit, and no this was not because any of you deserved when the dean asks me 'hey why the …, did 90% of your class fail an introductory Biology class" to whom I will reply "Hmmm I don't know, maybe its because these klingons are 18 years old and stil gigge everytime I say the term "Phagocytosis Id like to add that in fact one of you got a 5/100 on this exam for which I salute you Considering it was 100% multiple choice and the statistical probability of you missing more than 90% GUESSING actual act of God (please stay out of the gene pool you know who you are). I could have actually taken a shit on the scantron, wiped off on the grass, and I am pretty certain my feces would have picked up more correct answers than you deliberately bubbled in So congratulations, on making me lose faith in the public school system, and in humanity 50 point grade bump as it but it was infact so I don't get my e fired is actually higher than your chances of getting laid, which for this particular student would be an loloftheday: The Professor is Not Mad… Just Disappointed
The Professor is Not Mad Just Disappointed: All Course Announcement Fall 2016 BIO 101 15 General Biology I Final Exam Grades Open Dismiss Hi, All I have your final exam grades 5 minutes ago Guys I really wanted to believe that Virginia Westem was not the cesspool of morons all my fellow Biology faculty told me it would be Unfortunatly your finals, which I purposely made as easy as humanly possible tanked harder than a Kardashian marriage I personally apologize for expecting the bare minimum from you as students. If you look at your grade book you will notice that you have all gotten a extra credit, and no this was not because any of you deserved when the dean asks me 'hey why the …, did 90% of your class fail an introductory Biology class" to whom I will reply "Hmmm I don't know, maybe its because these klingons are 18 years old and stil gigge everytime I say the term "Phagocytosis Id like to add that in fact one of you got a 5/100 on this exam for which I salute you Considering it was 100% multiple choice and the statistical probability of you missing more than 90% GUESSING actual act of God (please stay out of the gene pool you know who you are). I could have actually taken a shit on the scantron, wiped off on the grass, and I am pretty certain my feces would have picked up more correct answers than you deliberately bubbled in So congratulations, on making me lose faith in the public school system, and in humanity 50 point grade bump as it but it was infact so I don't get my e fired is actually higher than your chances of getting laid, which for this particular student would be an The Professor is Not Mad Just Disappointed
<p><a href="http://noelleian.tumblr.com/post/169002539157/calleo-bogleech-raw-fed-pets-faofox" class="tumblr_blog">noelleian</a>:</p> <blockquote><p><a href="http://calleo.tumblr.com/post/168968744159/bogleech-raw-fed-pets-faofox" class="tumblr_blog">calleo</a>:</p><blockquote> <p><a class="tumblr_blog" href="http://bogleech.tumblr.com/post/93450647663">bogleech</a>:</p> <blockquote> <p><a class="tumblr_blog" href="http://raw-fed-pets.tumblr.com/post/90406730386">raw-fed-pets</a>:</p> <blockquote> <p><a class="tumblr_blog" href="http://faofox.tumblr.com/post/90404102112">faofox</a>:</p> <blockquote> <p><a class="tumblr_blog" href="http://raw-fed-pets.tumblr.com/post/90389499204">raw-fed-pets</a>:</p> <blockquote> <p>All dogs share the same basic digestive system despite the range of physical variations (and attitudes) across different breeds. Every dog is designed to eat a raw animal-based diet, from the Chihuahua to the Great Dane. Breed-specific dog food brands are simply a marketing gimmick aimed at playing on the pet owner’s emotions, and their desire to feed their pet the best possible diet.</p> </blockquote> <p>I don’t think that dogs need an animal-based diet. If done right they can be vegan and not contribute to the murdering of innocent animals. We’ve adapted and domesticated them enough to do so. They’ve evolved to live without meat just like us.</p> </blockquote> <p>200% incorrect. Vegan diets are carbohydrate-based. Carbohydrates are inflammatory, feed cancer (glucose), contribute to periodontal disease (leading to systemic organ failure, eg heart), cause insulin spikes leading to a multitude of other issues in the long-term (thyroid, liver, diabetes, heart disease) and also cause pancreatic problems due to extreme stress on the pancreas (secreting heavy loads of carb enzymes over a long period of time). The low moisture content coupled with high <em>plant</em> protein may also cause renal failure in the long term. The preservatives used may also be linked to cancer (BHA, BHT etc), and these diets also skew the omega3/6 ratio, causing further inflammation (linked to cancer again). They cause urine alkalinity leading to urinary problems such as crystals, blockages and UTI’s.</p> <p>Brief into to dog anatomy/physiology:</p> <p>- Stomach PH: Their highly acidic stomach is designed for eliminating harmful bacteria and breaking down bone into a gel-like substance. Humans have a much more alkaline stomach acid which is why we would struggle to digest raw bone.</p> <p>-Digestive Enzymes: Higher level of proteases to break down animal protein. High bile load to help push through bacteria.</p> <p>-Dental Anatomy: Sharp pointed teeth designed for ripping and tearing flesh and bones.Dogs do not chew their food as we do, they are wired to swallow chunks quickly as a basic survival instinct.</p> <p>-Jaws: Dogs also have strong jaws that physically <strong>cannot</strong> move sideways (like your own can). This sideways grinding action is a feature that allows pre-digestion of plant material. Again, dogs rip off chunks and swallow them whole.</p> <p>-Lack of Salivary Amylase: Omnivores have this for pre-digestion of carbohydrates. Dogs and cats do not. The canine pancreas secretes amylase as a backup, however this does not mean they <em>should</em> be fed a high carbohydrate diet every day for a lifetime. Processed food (incl vegan) is 40-70% carbohydrate.</p> <p>-Lysozyme: Instead of amylase, dogs have lysozyme in their saliva which is an antibacterial. This may be useful for destroying any harmful bacteria in carrion/rotten food/feces, as well as wound cleaning.</p> <p>-Gut length: The canine gut is short in length which is because flesh must be pushed through quickly. It does not need to sit and ferment, as this could allow bacteria to multiply to harmful levels. Note that plant eating animals have a long digestive tract and even multiple stomach chambers in order for plant material to be slowly broken down by the necessary enzymes.</p> <p>-Nutrient profiles. Dogs have 0% biological requirement for carbohydrates. They gain every single essential nutrient from a prey based diet such as Whole Prey/Prey Model. Vegan diets are full of processed lab-made vitamins and minerals. Many vitamin pre-mixes are made in china and shipped to the country of manufacture.</p> <p>All in all, dogs will <em>survive</em> on a high carbohydrate diet but it will cause systemic effects eventually. Similar to smoking, a junk food diet affects every dog differently and some may be affected more severely than others, and in different time spans. You can also expect high vet fees in the form of dental cleanings, dental surgeries and various health problem later on in life.</p> <p>It is not recommended that you feed your pet the equivalent of a big mac for the entirety of its life. This is essentially what kibble and vegan diets are. Evolution has changed the appearance and even the behaviour of your dog, but their digestive system is still geared towards meat. <strong>Basically, you are paying money to have a company slowly kill your pet from the inside out. <br/></strong></p> <p><strong>0/10, Not Recommended.</strong></p> </blockquote> <p>Hard science here for anyone who needs to shut down a “vegan pet owner.” It’s abuse. Feed your animal the substances they evolved to eat or do not own an animal, it’s as simple as that.</p> </blockquote> <p>Vegan dog and cat owners who try to force their pets to be vegan are absolute trash and should be dragged as hard as possible for their dangerously bad beliefs.</p> </blockquote> <p><a class="tumblelog" href="https://tmblr.co/m6yjzgQMTLlgckIf5tMtRUA">@faofox</a> Don’t ever get a dog. Please. And if you have one, find a new home for it before you wind up killing it.</p></blockquote> <p>It is absolutely moronic to feed your carnivorous pets a vegan diet. Don’t you dare call yourself someone concerned with animal rights if you support starving an animal to death.</p>: <p><a href="http://noelleian.tumblr.com/post/169002539157/calleo-bogleech-raw-fed-pets-faofox" class="tumblr_blog">noelleian</a>:</p> <blockquote><p><a href="http://calleo.tumblr.com/post/168968744159/bogleech-raw-fed-pets-faofox" class="tumblr_blog">calleo</a>:</p><blockquote> <p><a class="tumblr_blog" href="http://bogleech.tumblr.com/post/93450647663">bogleech</a>:</p> <blockquote> <p><a class="tumblr_blog" href="http://raw-fed-pets.tumblr.com/post/90406730386">raw-fed-pets</a>:</p> <blockquote> <p><a class="tumblr_blog" href="http://faofox.tumblr.com/post/90404102112">faofox</a>:</p> <blockquote> <p><a class="tumblr_blog" href="http://raw-fed-pets.tumblr.com/post/90389499204">raw-fed-pets</a>:</p> <blockquote> <p>All dogs share the same basic digestive system despite the range of physical variations (and attitudes) across different breeds. Every dog is designed to eat a raw animal-based diet, from the Chihuahua to the Great Dane. Breed-specific dog food brands are simply a marketing gimmick aimed at playing on the pet owner’s emotions, and their desire to feed their pet the best possible diet.</p> </blockquote> <p>I don’t think that dogs need an animal-based diet. If done right they can be vegan and not contribute to the murdering of innocent animals. We’ve adapted and domesticated them enough to do so. They’ve evolved to live without meat just like us.</p> </blockquote> <p>200% incorrect. Vegan diets are carbohydrate-based. Carbohydrates are inflammatory, feed cancer (glucose), contribute to periodontal disease (leading to systemic organ failure, eg heart), cause insulin spikes leading to a multitude of other issues in the long-term (thyroid, liver, diabetes, heart disease) and also cause pancreatic problems due to extreme stress on the pancreas (secreting heavy loads of carb enzymes over a long period of time). The low moisture content coupled with high <em>plant</em> protein may also cause renal failure in the long term. The preservatives used may also be linked to cancer (BHA, BHT etc), and these diets also skew the omega3/6 ratio, causing further inflammation (linked to cancer again). They cause urine alkalinity leading to urinary problems such as crystals, blockages and UTI’s.</p> <p>Brief into to dog anatomy/physiology:</p> <p>- Stomach PH: Their highly acidic stomach is designed for eliminating harmful bacteria and breaking down bone into a gel-like substance. Humans have a much more alkaline stomach acid which is why we would struggle to digest raw bone.</p> <p>-Digestive Enzymes: Higher level of proteases to break down animal protein. High bile load to help push through bacteria.</p> <p>-Dental Anatomy: Sharp pointed teeth designed for ripping and tearing flesh and bones.Dogs do not chew their food as we do, they are wired to swallow chunks quickly as a basic survival instinct.</p> <p>-Jaws: Dogs also have strong jaws that physically <strong>cannot</strong> move sideways (like your own can). This sideways grinding action is a feature that allows pre-digestion of plant material. Again, dogs rip off chunks and swallow them whole.</p> <p>-Lack of Salivary Amylase: Omnivores have this for pre-digestion of carbohydrates. Dogs and cats do not. The canine pancreas secretes amylase as a backup, however this does not mean they <em>should</em> be fed a high carbohydrate diet every day for a lifetime. Processed food (incl vegan) is 40-70% carbohydrate.</p> <p>-Lysozyme: Instead of amylase, dogs have lysozyme in their saliva which is an antibacterial. This may be useful for destroying any harmful bacteria in carrion/rotten food/feces, as well as wound cleaning.</p> <p>-Gut length: The canine gut is short in length which is because flesh must be pushed through quickly. It does not need to sit and ferment, as this could allow bacteria to multiply to harmful levels. Note that plant eating animals have a long digestive tract and even multiple stomach chambers in order for plant material to be slowly broken down by the necessary enzymes.</p> <p>-Nutrient profiles. Dogs have 0% biological requirement for carbohydrates. They gain every single essential nutrient from a prey based diet such as Whole Prey/Prey Model. Vegan diets are full of processed lab-made vitamins and minerals. Many vitamin pre-mixes are made in china and shipped to the country of manufacture.</p> <p>All in all, dogs will <em>survive</em> on a high carbohydrate diet but it will cause systemic effects eventually. Similar to smoking, a junk food diet affects every dog differently and some may be affected more severely than others, and in different time spans. You can also expect high vet fees in the form of dental cleanings, dental surgeries and various health problem later on in life.</p> <p>It is not recommended that you feed your pet the equivalent of a big mac for the entirety of its life. This is essentially what kibble and vegan diets are. Evolution has changed the appearance and even the behaviour of your dog, but their digestive system is still geared towards meat. <strong>Basically, you are paying money to have a company slowly kill your pet from the inside out. <br/></strong></p> <p><strong>0/10, Not Recommended.</strong></p> </blockquote> <p>Hard science here for anyone who needs to shut down a “vegan pet owner.” It’s abuse. Feed your animal the substances they evolved to eat or do not own an animal, it’s as simple as that.</p> </blockquote> <p>Vegan dog and cat owners who try to force their pets to be vegan are absolute trash and should be dragged as hard as possible for their dangerously bad beliefs.</p> </blockquote> <p><a class="tumblelog" href="https://tmblr.co/m6yjzgQMTLlgckIf5tMtRUA">@faofox</a> Don’t ever get a dog. Please. And if you have one, find a new home for it before you wind up killing it.</p></blockquote> <p>It is absolutely moronic to feed your carnivorous pets a vegan diet. Don’t you dare call yourself someone concerned with animal rights if you support starving an animal to death.</p>

<p><a href="http://noelleian.tumblr.com/post/169002539157/calleo-bogleech-raw-fed-pets-faofox" class="tumblr_blog">noelleian</a>:</p> <b...

Jurors Recommend The Death Penalty For Man Who Tortured and Murdered His Girlfriend’s 8-Year-Old Son - blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Last month, 37-year-old Isauro Aguirre was convicted of first-degree murder, four years after his girlfriend’s 8-year-old son died from repeated abuse. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Gabriel Fernandez was found inside his Palmdale home on May 22, 2013, with a cracked skull, broken ribs, burned skin, missing teeth and BB gun pellets in his groin area, LA Times reports. During Aguirre’s trial, prosecutors detailed the abuse Fernandez suffered at the hands of his mother and her boyfriend, Aguirre. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Fernandez was forced to eat cat feces and his own throw-up. The couple also made the young boy sleep in a cabinet with his hands and ankles bound. Prosecutors also revealed Fernandez was punched in the face so hard that it tore the skin from his chin and nose. Two days after officials found Fernandez in the home, the little boy died from his injuries. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On Wednesday, Aguirre’s penalty for his conviction was read before the court. Although the defense asked for a less severe sentence, as Aguirre suffers from a learning disability, the jurors voted on the death penalty for the brutal murder and torture of Gabriel Fernandez. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to the LATimes, Fernandez’s case also led to criminal charges against L.A. County social workers, since they left Fernandez at the home after six investigations into abuse involving his mother, who is also charged with murder.: Jurors Recommend The Death Penalty For Man Who Tortured and Murdered His Girlfriend's 8-Year-Old Son @balleralert Jurors Recommend The Death Penalty For Man Who Tortured and Murdered His Girlfriend’s 8-Year-Old Son - blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Last month, 37-year-old Isauro Aguirre was convicted of first-degree murder, four years after his girlfriend’s 8-year-old son died from repeated abuse. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Gabriel Fernandez was found inside his Palmdale home on May 22, 2013, with a cracked skull, broken ribs, burned skin, missing teeth and BB gun pellets in his groin area, LA Times reports. During Aguirre’s trial, prosecutors detailed the abuse Fernandez suffered at the hands of his mother and her boyfriend, Aguirre. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Fernandez was forced to eat cat feces and his own throw-up. The couple also made the young boy sleep in a cabinet with his hands and ankles bound. Prosecutors also revealed Fernandez was punched in the face so hard that it tore the skin from his chin and nose. Two days after officials found Fernandez in the home, the little boy died from his injuries. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On Wednesday, Aguirre’s penalty for his conviction was read before the court. Although the defense asked for a less severe sentence, as Aguirre suffers from a learning disability, the jurors voted on the death penalty for the brutal murder and torture of Gabriel Fernandez. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to the LATimes, Fernandez’s case also led to criminal charges against L.A. County social workers, since they left Fernandez at the home after six investigations into abuse involving his mother, who is also charged with murder.

Jurors Recommend The Death Penalty For Man Who Tortured and Murdered His Girlfriend’s 8-Year-Old Son - blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀...

<p><a href="https://patron-saint-of-smart-asses.tumblr.com/post/167169381419/empiricalanecdotes-impulsebyimpulse-no-you" class="tumblr_blog">patron-saint-of-smart-asses</a>:</p> <blockquote><p><a href="https://empiricalanecdotes.tumblr.com/post/160123029607/impulsebyimpulse-no-you-do-not-get-to-turn-the" class="tumblr_blog">empiricalanecdotes</a>:</p> <blockquote> <p><a href="http://impulsebyimpulse.tumblr.com/post/160105400925/no-you-do-not-get-to-turn-the-systematic-slaughter" class="tumblr_blog">impulsebyimpulse</a>:</p> <blockquote> <p>NO</p> <p>You do not get to turn the systematic slaughter of my ancestors into your crusade! This was not Islam. This was not about religion! This was about race. This was about the Turkish government seeing a minority they could exploit and use as scape goat’s for the Ottoman empire collapsing. This was about the Armenians siding with Russia in World War I and conflicts before hand.</p> <p>As a woman of Armenian descent and as a proud Christian <i>HOW DARE YOU</i> use my people’s suffering as fodder for your hatred and ill will. You don’t care about Armenians. You don’t care about these girls. You care about getting people to believe as you do or die for refusing.<br/></p> </blockquote> <p><a href="http://www.thecommentator.com/article/5790/ignoring_the_armenian_genocide_by_the_last_islamic_caliphate">http://www.thecommentator.com/article/5790/ignoring_the_armenian_genocide_by_the_last_islamic_caliphate</a><br/></p> <h2><b> Ignoring the Armenian genocide by the last Islamic caliphate</b></h2> <h2>The genocide of Armenian Christians by Ottoman Muslims was very real, so was the appalling torture. Women were raped and crucified, people had horseshoes nailed to their feet as they were marched through the streets. Unspeakable atrocities were perpetrated. Yet almost no-one in the Islamic world, and too few in the West will acknowledge it even happened.</h2> <p>As the world continues to look on in dismay at the barbaric atrocities committed against Christian minorities by the Islamic State – the self-proclaimed new “caliphate” – today, April 24, marks the genocide of Armenian and other Christian minorities by Turkey’s Islamic Ottoman Empire, the last caliphate.</p> <p>Most <a href="http://www.anca.org/genocide/denial.php">American historians</a> who have examined the question agree that what the Armenians experienced was a deliberate, calculated genocide:</p> <p>More than one million Armenians perished as the result of execution, starvation, disease, the harsh environment, and physical abuse. A people who lived in eastern Turkey for nearly 3,000 years [that is, 2,500 years before the Islamic Turks invaded and occupied Anatolia, now known as “Turkey”] lost its homeland and was profoundly decimated in the first large-scale genocide of the twentieth century. At the beginning of 1915 there were some two million Armenians within Turkey; today there are fewer than 60,000.</p> <p>One-and-a-half million Armenians were eradicated. If early 20<sup>th</sup> century Turkey had had the apparatuses and technology to execute in mass – such as 1940s Germany’s gas chambers – the entire Armenian population could well have been annihilated.</p> <p>The atrocities suffered by Armenian and other Christian minorities are too long to list. As occurs under the current caliphate – the Islamic State – the Muslims of the Ottoman caliphate abducted, raped, and slaughtered or sold countless Christian women and children on the Muslim slave markets.</p> <p>Armenian Christians were also sadistically tortured – as Christians are today under the Islamic State.</p> <p>On <a href="http://www.frontpagemag.com/2015/lloyd-billingsley/the-islamic-state-then-and-now/">FrontPage Magazine</a>, Lloyd Billingsley writes:</p> <p>Torture squads would apply red-hot irons, tear off flesh with hot pincers, then pour boiled butter into the wounds. The soles of the feet would be beaten, slashed, and laced with salt. Dr. Mehmed Reshid tortured Armenians by nailing horseshoes to their feet and marching them through the streets. He also crucified them on makeshift crosses.</p> <p>The Muslims hacked Armenians to pieces and dashed infants on the rocks before their mothers. They burned bodies not for sanitary reasons but in search of gold coins they believed the Armenians had swallowed. The Muslims also tore apart the victims’ feces in the search for gold. U.S. consul Leslie Davis, a former attorney and journalist, documented the Islamic zeal.</p> <p>“We could all hear them piously calling upon Allah to bless them in their efforts to kill the hated Christians,” Davis wrote. “Night after night this same chant went up to heaven and day after day these Turks carried on their bloody work.” Around Lake Goeljik, Davis wrote, “thousands and thousands of Armenians, mostly innocent and helpless women and children, were butchered on its shores and barbarously mutilated.”</p> <p>In her memoir, Ravished Armenia, <a href="http://www.genocide-museum.am/eng/online_exhibition_6.php">Aurora Mardiganian</a> described being raped and thrown into a harem – <a href="http://www.raymondibrahim.com/islam/muhammad-and-islams-sex-slaves/">akin to the experiences of today’s non-Muslims under Islamic State authority</a>.</p> <p>Unlike thousands of other Armenian girls who were killed after being defiled, she managed to escape. She recalls seeing <a href="http://books.google.com/books?id=r_O_lkCGHOsC&amp;pg=PA107&amp;lpg=PA107&amp;dq=%E2%80%9CEach+girl+had+been+nailed+alive+upon+her+cross,+spikes+through+her+feet+and+hands,%E2%80%9D&amp;source=bl&amp;ots=610-sOzCgq&amp;sig=3Na9l_6_2Bci2ulLu7HOFVxsYD0&amp;hl=en&amp;sa=X&amp;ei=cAp4UYyRIqXriwK0rYGICw&amp;ved=0CEAQ6AEwAg#v=onepage&amp;q=%E2%80%9CEach%20girl%20had%20been%20nailed%20alive%20upon%20her%20cross%2C%20spikes%20through%20her%20feet%20and%20hands%2C%E2%80%9D&amp;f=false">16 Christian girls crucified</a> in Malatia: “Each girl had been nailed alive upon her cross, spikes through her feet and hands, only their hair blown by the wind, covered their bodies.”</p> <p>Because there is no dearth of evidence concerning the historical reality of the Armenian Genocide, 44 U.S. States have recognized it. South Dakota, which recently joined the list, <a href="http://armenianweekly.com/2015/02/26/south-dakota/">passed a resolution</a> in February 2015 calling on</p> <p>Congress and the president of the United States to formally and consistently recognize and reaffirm the historical truth that the atrocities committed against the Armenian, Greek, and other Christians living in their historical homelands in Anatolia constituted genocide and to work towards equitable, stable, and durable Armenian-Turkish relations.</p> <p>Turkey, of course, continues to deny that its forbears ever committed any genocide. As a group of American academics <a href="http://www.anca.org/assets/pdf/armenian_genocide_reference/professionalethics_lifton.pdf">wrote back in 1995</a>,</p> <p>Despite the vast amount of evidence that points to the historical reality of the Armenian Genocide – eyewitness accounts, official archives, photographic evidence, the reports of diplomats, and the testimony of survivors – denial of the Armenian Genocide by successive regimes in Turkey has gone on from 1915 to the present.</p> <p>Nor is the Islamic government of Turkey alone in denying the genocide. President Obama still refuses to acknowledge it – even though when he was running for office in 2008 <a href="https://web.archive.org/web/20081117033141/http:/www.barackobama.com/2008/01/19/barack_obama_on_the_importance.php">he professed his</a>:</p> <p>firmly held conviction that the Armenian Genocide is not an allegation, a personal opinion, or a point of view, but rather a widely documented fact supported by an overwhelming body of historical evidence. The facts are undeniable….  [A]s President I will recognize the Armenian Genocide….  America deserves a leader who speaks truthfully about the Armenian Genocide and responds forcefully to all genocides. I intend to be that president.</p> <p>Since taking office, Obama has refused to stand by his word. On Tuesday, April 21, the White House announced that it would again, for the seventh year since Obama’s pledge, not use the word “genocide,” thereby disappointing many human rights activists.</p> <p>Writes the <a href="http://www.nytimes.com/2015/04/22/world/europe/white-house-acknowledges-armenian-genocide-but-avoids-the-term.html?_r=0">New York Times</a>:</p> <p>The president’s continued resistance to the word stood in contrast to a stance by Pope Francis, who recently called the massacres “the first genocide of the 20th century” and equated them to mass killings by the Nazis and Soviets. The European Parliament, which first recognized the genocide in 1987, passed a resolution last week calling on Turkey to “come to terms with its past.”</p> <p>The Armenian National Committee of America responded by saying: “The president’s surrender represents a national disgrace. It is a betrayal of the truth, and it is a betrayal of trust.”  The Armenian Assembly of America said “His failure to use the term genocide represents a major blow for human rights advocates.”</p> <p>But the president’s actions are consistent in other ways. Put differently, it is no marvel that Obama denies the genocide of Armenian and other Christian minorities at the hands of Muslims from a century ago, when one considers that he denies the rampant Muslim persecution of Christians taking place under – <a href="http://www.raymondibrahim.com/muslim-persecution-of-christians/confirmed-u-s-chief-facilitator-of-christian-persecution/">and often partly because of</a> – his leadership today.</p> <p>Raymond Ibrahim, a regular contributor to <a href="http://www.thecommentator.com/">The Commentator</a>, is author of <a href="http://www.amazon.com/gp/product/1621570258/ref=as_li_qf_sp_asin_il_tl?ie=UTF8&amp;camp=1789&amp;creative=9325&amp;creativeASIN=1621570258&amp;linkCode=as2&amp;tag=uhurnetw-20">Crucified Again: Exposing Islam’s New War on Christians</a></p> </blockquote> <p> “You care about getting people to believe as you do or die for refusing.” <a class="tumblelog" href="https://tmblr.co/mmzaZqAtysnVR1iZrVV8erw">@impulsebyimpulse</a> I’m pretty sure that’s what the Caliphate did to the Armenians and what IS is doing now to their own enemies; are you really convinced this tumblr post is calling for the death of people who deny the Muslim involvement in these genocides and terror attacks? Get a grip, preferably in reality.<br/></p></blockquote> Sane person: &ldquo;So anyway this horrible genocide was committed by Muslims.&rdquo; <a class="tumblelog" href="https://tmblr.co/mmzaZqAtysnVR1iZrVV8erw">@impulsebyimpulse</a>: &ldquo;HOW DARE YOU BRING THAT UP! YOU JUST WANT AN EXCUSE FOR HATRED!&rdquo; Not every genocide was committed by Muslims, but this particular one was. It&rsquo;s a statement of fact and you don&rsquo;t get to get upset about it because it might make Muslims look bad.: Crucified Armenian Christian Girls Islam is responsible for the ARMENIAN GENOCIDE, in which 2 million Armenian Christians were murdered and starved to death by the Ottoman Caliphate. This is what ISLAM does to our Christian girls. SHARIA LAW is evil, Muslim leaders in America are working to a Caliphate in America <p><a href="https://patron-saint-of-smart-asses.tumblr.com/post/167169381419/empiricalanecdotes-impulsebyimpulse-no-you" class="tumblr_blog">patron-saint-of-smart-asses</a>:</p> <blockquote><p><a href="https://empiricalanecdotes.tumblr.com/post/160123029607/impulsebyimpulse-no-you-do-not-get-to-turn-the" class="tumblr_blog">empiricalanecdotes</a>:</p> <blockquote> <p><a href="http://impulsebyimpulse.tumblr.com/post/160105400925/no-you-do-not-get-to-turn-the-systematic-slaughter" class="tumblr_blog">impulsebyimpulse</a>:</p> <blockquote> <p>NO</p> <p>You do not get to turn the systematic slaughter of my ancestors into your crusade! This was not Islam. This was not about religion! This was about race. This was about the Turkish government seeing a minority they could exploit and use as scape goat’s for the Ottoman empire collapsing. This was about the Armenians siding with Russia in World War I and conflicts before hand.</p> <p>As a woman of Armenian descent and as a proud Christian <i>HOW DARE YOU</i> use my people’s suffering as fodder for your hatred and ill will. You don’t care about Armenians. You don’t care about these girls. You care about getting people to believe as you do or die for refusing.<br/></p> </blockquote> <p><a href="http://www.thecommentator.com/article/5790/ignoring_the_armenian_genocide_by_the_last_islamic_caliphate">http://www.thecommentator.com/article/5790/ignoring_the_armenian_genocide_by_the_last_islamic_caliphate</a><br/></p> <h2><b> Ignoring the Armenian genocide by the last Islamic caliphate</b></h2> <h2>The genocide of Armenian Christians by Ottoman Muslims was very real, so was the appalling torture. Women were raped and crucified, people had horseshoes nailed to their feet as they were marched through the streets. Unspeakable atrocities were perpetrated. Yet almost no-one in the Islamic world, and too few in the West will acknowledge it even happened.</h2> <p>As the world continues to look on in dismay at the barbaric atrocities committed against Christian minorities by the Islamic State – the self-proclaimed new “caliphate” – today, April 24, marks the genocide of Armenian and other Christian minorities by Turkey’s Islamic Ottoman Empire, the last caliphate.</p> <p>Most <a href="http://www.anca.org/genocide/denial.php">American historians</a> who have examined the question agree that what the Armenians experienced was a deliberate, calculated genocide:</p> <p>More than one million Armenians perished as the result of execution, starvation, disease, the harsh environment, and physical abuse. A people who lived in eastern Turkey for nearly 3,000 years [that is, 2,500 years before the Islamic Turks invaded and occupied Anatolia, now known as “Turkey”] lost its homeland and was profoundly decimated in the first large-scale genocide of the twentieth century. At the beginning of 1915 there were some two million Armenians within Turkey; today there are fewer than 60,000.</p> <p>One-and-a-half million Armenians were eradicated. If early 20<sup>th</sup> century Turkey had had the apparatuses and technology to execute in mass – such as 1940s Germany’s gas chambers – the entire Armenian population could well have been annihilated.</p> <p>The atrocities suffered by Armenian and other Christian minorities are too long to list. As occurs under the current caliphate – the Islamic State – the Muslims of the Ottoman caliphate abducted, raped, and slaughtered or sold countless Christian women and children on the Muslim slave markets.</p> <p>Armenian Christians were also sadistically tortured – as Christians are today under the Islamic State.</p> <p>On <a href="http://www.frontpagemag.com/2015/lloyd-billingsley/the-islamic-state-then-and-now/">FrontPage Magazine</a>, Lloyd Billingsley writes:</p> <p>Torture squads would apply red-hot irons, tear off flesh with hot pincers, then pour boiled butter into the wounds. The soles of the feet would be beaten, slashed, and laced with salt. Dr. Mehmed Reshid tortured Armenians by nailing horseshoes to their feet and marching them through the streets. He also crucified them on makeshift crosses.</p> <p>The Muslims hacked Armenians to pieces and dashed infants on the rocks before their mothers. They burned bodies not for sanitary reasons but in search of gold coins they believed the Armenians had swallowed. The Muslims also tore apart the victims’ feces in the search for gold. U.S. consul Leslie Davis, a former attorney and journalist, documented the Islamic zeal.</p> <p>“We could all hear them piously calling upon Allah to bless them in their efforts to kill the hated Christians,” Davis wrote. “Night after night this same chant went up to heaven and day after day these Turks carried on their bloody work.” Around Lake Goeljik, Davis wrote, “thousands and thousands of Armenians, mostly innocent and helpless women and children, were butchered on its shores and barbarously mutilated.”</p> <p>In her memoir, Ravished Armenia, <a href="http://www.genocide-museum.am/eng/online_exhibition_6.php">Aurora Mardiganian</a> described being raped and thrown into a harem – <a href="http://www.raymondibrahim.com/islam/muhammad-and-islams-sex-slaves/">akin to the experiences of today’s non-Muslims under Islamic State authority</a>.</p> <p>Unlike thousands of other Armenian girls who were killed after being defiled, she managed to escape. She recalls seeing <a href="http://books.google.com/books?id=r_O_lkCGHOsC&amp;pg=PA107&amp;lpg=PA107&amp;dq=%E2%80%9CEach+girl+had+been+nailed+alive+upon+her+cross,+spikes+through+her+feet+and+hands,%E2%80%9D&amp;source=bl&amp;ots=610-sOzCgq&amp;sig=3Na9l_6_2Bci2ulLu7HOFVxsYD0&amp;hl=en&amp;sa=X&amp;ei=cAp4UYyRIqXriwK0rYGICw&amp;ved=0CEAQ6AEwAg#v=onepage&amp;q=%E2%80%9CEach%20girl%20had%20been%20nailed%20alive%20upon%20her%20cross%2C%20spikes%20through%20her%20feet%20and%20hands%2C%E2%80%9D&amp;f=false">16 Christian girls crucified</a> in Malatia: “Each girl had been nailed alive upon her cross, spikes through her feet and hands, only their hair blown by the wind, covered their bodies.”</p> <p>Because there is no dearth of evidence concerning the historical reality of the Armenian Genocide, 44 U.S. States have recognized it. South Dakota, which recently joined the list, <a href="http://armenianweekly.com/2015/02/26/south-dakota/">passed a resolution</a> in February 2015 calling on</p> <p>Congress and the president of the United States to formally and consistently recognize and reaffirm the historical truth that the atrocities committed against the Armenian, Greek, and other Christians living in their historical homelands in Anatolia constituted genocide and to work towards equitable, stable, and durable Armenian-Turkish relations.</p> <p>Turkey, of course, continues to deny that its forbears ever committed any genocide. As a group of American academics <a href="http://www.anca.org/assets/pdf/armenian_genocide_reference/professionalethics_lifton.pdf">wrote back in 1995</a>,</p> <p>Despite the vast amount of evidence that points to the historical reality of the Armenian Genocide – eyewitness accounts, official archives, photographic evidence, the reports of diplomats, and the testimony of survivors – denial of the Armenian Genocide by successive regimes in Turkey has gone on from 1915 to the present.</p> <p>Nor is the Islamic government of Turkey alone in denying the genocide. President Obama still refuses to acknowledge it – even though when he was running for office in 2008 <a href="https://web.archive.org/web/20081117033141/http:/www.barackobama.com/2008/01/19/barack_obama_on_the_importance.php">he professed his</a>:</p> <p>firmly held conviction that the Armenian Genocide is not an allegation, a personal opinion, or a point of view, but rather a widely documented fact supported by an overwhelming body of historical evidence. The facts are undeniable….  [A]s President I will recognize the Armenian Genocide….  America deserves a leader who speaks truthfully about the Armenian Genocide and responds forcefully to all genocides. I intend to be that president.</p> <p>Since taking office, Obama has refused to stand by his word. On Tuesday, April 21, the White House announced that it would again, for the seventh year since Obama’s pledge, not use the word “genocide,” thereby disappointing many human rights activists.</p> <p>Writes the <a href="http://www.nytimes.com/2015/04/22/world/europe/white-house-acknowledges-armenian-genocide-but-avoids-the-term.html?_r=0">New York Times</a>:</p> <p>The president’s continued resistance to the word stood in contrast to a stance by Pope Francis, who recently called the massacres “the first genocide of the 20th century” and equated them to mass killings by the Nazis and Soviets. The European Parliament, which first recognized the genocide in 1987, passed a resolution last week calling on Turkey to “come to terms with its past.”</p> <p>The Armenian National Committee of America responded by saying: “The president’s surrender represents a national disgrace. It is a betrayal of the truth, and it is a betrayal of trust.”  The Armenian Assembly of America said “His failure to use the term genocide represents a major blow for human rights advocates.”</p> <p>But the president’s actions are consistent in other ways. Put differently, it is no marvel that Obama denies the genocide of Armenian and other Christian minorities at the hands of Muslims from a century ago, when one considers that he denies the rampant Muslim persecution of Christians taking place under – <a href="http://www.raymondibrahim.com/muslim-persecution-of-christians/confirmed-u-s-chief-facilitator-of-christian-persecution/">and often partly because of</a> – his leadership today.</p> <p>Raymond Ibrahim, a regular contributor to <a href="http://www.thecommentator.com/">The Commentator</a>, is author of <a href="http://www.amazon.com/gp/product/1621570258/ref=as_li_qf_sp_asin_il_tl?ie=UTF8&amp;camp=1789&amp;creative=9325&amp;creativeASIN=1621570258&amp;linkCode=as2&amp;tag=uhurnetw-20">Crucified Again: Exposing Islam’s New War on Christians</a></p> </blockquote> <p> “You care about getting people to believe as you do or die for refusing.” <a class="tumblelog" href="https://tmblr.co/mmzaZqAtysnVR1iZrVV8erw">@impulsebyimpulse</a> I’m pretty sure that’s what the Caliphate did to the Armenians and what IS is doing now to their own enemies; are you really convinced this tumblr post is calling for the death of people who deny the Muslim involvement in these genocides and terror attacks? Get a grip, preferably in reality.<br/></p></blockquote> Sane person: &ldquo;So anyway this horrible genocide was committed by Muslims.&rdquo; <a class="tumblelog" href="https://tmblr.co/mmzaZqAtysnVR1iZrVV8erw">@impulsebyimpulse</a>: &ldquo;HOW DARE YOU BRING THAT UP! YOU JUST WANT AN EXCUSE FOR HATRED!&rdquo; Not every genocide was committed by Muslims, but this particular one was. It&rsquo;s a statement of fact and you don&rsquo;t get to get upset about it because it might make Muslims look bad.
Trial Begins For Man Accused of Murdering Girlfriend's Son 'Because He Thought He Was Gay' - blogged by @baetoven_ ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The trial of Isauro Aguirre, the 37-year-old who is charged with murder for torturing and killing his girlfriend's 8-year-old son, has begun in LosAngeles. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Aguirre is accused of dousing GabrielFernandez in pepper spray, biting him, forcing him to eat his own vomit and feces, burning him with cigarettes, starving him, shooting him with a BB gun and beating him, alongside Gabriel's mother Pearl Fernandez. Prosecutors argue that Aguirre, who also reportedly made Gabriel wear girls clothes to school, abused the boy over an 8-month period because he thought he was gay. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ First responders found Gabriel gagged and restrained in a cabinet in his Palmdale, California home on May 22, 2013. He was taken off life support two days later after doctors determined he had no brain activity. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Defense attorneys acknowledge that Aguirre tortured Gabriel, but insisted the death was accidental and that the abuse only happened after the boy told his mom to leave Aguirre, propelling him into a violent rage. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Fernandez has also been charged with capital murder and will be tried separately. If convicted, they face the death penalty. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Four Los Angeles County social workers who were assigned to Gabriel's case also face child abuse charges, and charges for falsifying public records.: Trial Begins For Man Accused of Murdering Girlfriend's Son 'Because He Thought He Was Gay' Qballeralert Trial Begins For Man Accused of Murdering Girlfriend's Son 'Because He Thought He Was Gay' - blogged by @baetoven_ ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The trial of Isauro Aguirre, the 37-year-old who is charged with murder for torturing and killing his girlfriend's 8-year-old son, has begun in LosAngeles. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Aguirre is accused of dousing GabrielFernandez in pepper spray, biting him, forcing him to eat his own vomit and feces, burning him with cigarettes, starving him, shooting him with a BB gun and beating him, alongside Gabriel's mother Pearl Fernandez. Prosecutors argue that Aguirre, who also reportedly made Gabriel wear girls clothes to school, abused the boy over an 8-month period because he thought he was gay. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ First responders found Gabriel gagged and restrained in a cabinet in his Palmdale, California home on May 22, 2013. He was taken off life support two days later after doctors determined he had no brain activity. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Defense attorneys acknowledge that Aguirre tortured Gabriel, but insisted the death was accidental and that the abuse only happened after the boy told his mom to leave Aguirre, propelling him into a violent rage. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Fernandez has also been charged with capital murder and will be tried separately. If convicted, they face the death penalty. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Four Los Angeles County social workers who were assigned to Gabriel's case also face child abuse charges, and charges for falsifying public records.

Trial Begins For Man Accused of Murdering Girlfriend's Son 'Because He Thought He Was Gay' - blogged by @baetoven_ ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The tr...

Anon is a dissapointment: Anonymous | 741797107 6 min. ago .. 30 year old NEET wake up at 2pm had accident in sleep which I rolled around in grab cum-towel off nightstand and do my best to wipe the mess from my folds of fat tummy gurgles loudly, so hungry plop out of bed, navigate through shit jugs and piss bottles in my room 102.0 kB JPG waddle downstairs to check GBP board wait a minute to catch my breath before l look just enough Good Boy Points for some tendies and sauce! legs buckle under own weight roll myself into the living room where mummy is watching her favorite soap opera "mummy mummy I have enough Good Boy Points for some tendies!" >she turns to me with the most disqusting look on her face while I lay flat on the ground stuggling to get up "s-sure honey, le-let me just get some tendies for you'" she struggles to go to the kitchen without vomitting from the smell and sight of my obese, putrid, feces and semen covered she pulls the tendies out of the freezer after letting the oven heat up as she begins to cry into the sink I roll over and pull myself up to my high chair that starts to creak as I sit down have my crayons and Ninja Turtles coloring book to occupy me while I wait the tendies are finally done and she puts them on my plate she can't hold back the vomit as I open my mouth to eat some tendies and vomits all over my plate I can't let these tendies go to waste, so l eat them along with the vomit "yummy wummy tendies in my tummy thanks mummy do my best to muster a smile but the rows of decaying teeth only disgust mummy further high-chair finally breaks from my heft causes me to have another accident mum runs away to her room, sobbing uncontrollably, so ashamed of her baby boy I just sit there on floor, in my own filth, thinking about what a disappointment I am mfw Anon is a dissapointment