Thats
Thats

Thats

Behind The
Behind The

Behind The

From
From

From

The
The

The

Personalize
Personalize

Personalize

But
But

But

When
When

When

Gotted
Gotted

Gotted

Shoulders
Shoulders

Shoulders

Someone Looking
Someone Looking

Someone Looking

🔥 | Latest

Fire, Football, and Head: An Assistant Football Coach Lost His Life Shielding Students Against Florida High School Shooter @balleralert An Assistant Football Coach Lost His Life Shielding Students In Florida High School Shooting - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ An assistant football coach lost his life protecting students during the Marjory Stoneman Douglas High School shooting on Wednesday. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ AaronFeis worked as a coach for the high school’s football team. This Thursday, the team tweeted that he “selflessly shielded students from the shooter when he was shot. He died a hero and he will forever be in our hearts and memories.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Nicolas Cruz is the 19-year old student who carried the act of terror onto his former school. Before the shooting, students thought they were merely performing a fire drill, which is what sent them filing into the hallways. That’s when Cruz, who was wearing a gas mask, toting smoke grenades and several magazines of ammunition for his AR-15 rifle, opened fire killing 17 and injuring more. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Feis at the time was on duty as the school security guard and responded to a call over walkie-talkies that there were loud pops coming from somewhere in the school. A witness said Feis was seen jumping “in front of bullets to save some students' lives.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ The brave coach was also an alumnus of the high school. He graduated from Marjory Stoneman Douglas High in 1999 and became the junior varsity head coach of the school’s football team in 2002. Feis leaves behind a wife and one daughter.
Fire, Football, and Head: An Assistant Football Coach Lost
 His Life Shielding Students Against
 Florida High School Shooter
 @balleralert
An Assistant Football Coach Lost His Life Shielding Students In Florida High School Shooting - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ An assistant football coach lost his life protecting students during the Marjory Stoneman Douglas High School shooting on Wednesday. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ AaronFeis worked as a coach for the high school’s football team. This Thursday, the team tweeted that he “selflessly shielded students from the shooter when he was shot. He died a hero and he will forever be in our hearts and memories.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Nicolas Cruz is the 19-year old student who carried the act of terror onto his former school. Before the shooting, students thought they were merely performing a fire drill, which is what sent them filing into the hallways. That’s when Cruz, who was wearing a gas mask, toting smoke grenades and several magazines of ammunition for his AR-15 rifle, opened fire killing 17 and injuring more. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Feis at the time was on duty as the school security guard and responded to a call over walkie-talkies that there were loud pops coming from somewhere in the school. A witness said Feis was seen jumping “in front of bullets to save some students' lives.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ The brave coach was also an alumnus of the high school. He graduated from Marjory Stoneman Douglas High in 1999 and became the junior varsity head coach of the school’s football team in 2002. Feis leaves behind a wife and one daughter.

An Assistant Football Coach Lost His Life Shielding Students In Florida High School Shooting - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀...

Advice, Future, and Ironic: eggrollie art has been hard lately but i made this banana today and its probably the height of my ability and i am ready novw a guest speaker in one of my classes recently gave some of the best advice I have ever received… 1. let curiosity be your compass - think about what you’re motivated to do, your affinity, your aspirations. what are the core reasons for your motivation? 2. impact is everything - if everything works out exactly as expected, why does it matter? what will you learn or change? 3. be James Bond - expose the side of yourself that will be received best. you don’t need to reveal everything about yourself upfront. 4. create strong partnerships - build a wise council. you only need three people: one who is a few steps ahead of you or where you want to be in the future, one who is progressing at the same pace as you, and one who is behind you but has experienced more. 5. to make space for what matters, you have to say no - we aren’t self-aware enough to know our breaking point before we reach it, so don’t be afraid to pass on some things. 6. create meaningful time - bingeing is not productive. establish clear morning rituals and practice contingency management. a slow and steady schedule is best. 7.when you rush from A to B, you miss everything in between - slow down and forget about your destination. take time to appreciate the path you’re on. 8.”the chief enemy of creativity is good sense” - be creative. just don’t lose touch with your common sense. 9.it’s supposed to be fun most of the time or something’s wrong - there will be spontaneous emotional breakdowns and seemingly impassible obstacles, but enjoy the journey of life billsimportantposts
Advice, Future, and Ironic: eggrollie
 art has been hard lately but i made this banana today and its probably the
 height of my ability and i am ready novw
a guest speaker in one of my classes recently gave some of the best advice I have ever received… 1. let curiosity be your compass - think about what you’re motivated to do, your affinity, your aspirations. what are the core reasons for your motivation? 2. impact is everything - if everything works out exactly as expected, why does it matter? what will you learn or change? 3. be James Bond - expose the side of yourself that will be received best. you don’t need to reveal everything about yourself upfront. 4. create strong partnerships - build a wise council. you only need three people: one who is a few steps ahead of you or where you want to be in the future, one who is progressing at the same pace as you, and one who is behind you but has experienced more. 5. to make space for what matters, you have to say no - we aren’t self-aware enough to know our breaking point before we reach it, so don’t be afraid to pass on some things. 6. create meaningful time - bingeing is not productive. establish clear morning rituals and practice contingency management. a slow and steady schedule is best. 7.when you rush from A to B, you miss everything in between - slow down and forget about your destination. take time to appreciate the path you’re on. 8.”the chief enemy of creativity is good sense” - be creative. just don’t lose touch with your common sense. 9.it’s supposed to be fun most of the time or something’s wrong - there will be spontaneous emotional breakdowns and seemingly impassible obstacles, but enjoy the journey of life billsimportantposts

a guest speaker in one of my classes recently gave some of the best advice I have ever received… 1. let curiosity be your compass - think ab...

Anaconda, Bailey Jay, and Billboard: Remembering Legendary Singer and lcon, Whitney Houston @balleralert Remembering Legendary Singer and Icon, Whitney Houston - blogged by @lanaladonna (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ It’s been six years since the death of legendary singer, actress, producer, and model, WhitneyHouston. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston died at 48 in 2012 after being found unconscious in a bathtub in a Beverly Hills hotel. It was reported that the singer passed due to cocaine use and heart disease. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston’s legacy included winning six Grammys and selling 170 million albums, singles, and videos over her career. Whitney, to this day, is the only artist to chart seven consecutive No. 1 Billboard Hot 100 songs and is the only woman to have two number-one Billboard 200 album awards. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston made her acting debut in “The Bodyguard” in 1992, where she performed the lead single from the film’s soundtrack, ‘I Will Always Love You.’ The song easily became a highlight of Houston’s career, and one of her signature records. It received the Grammy Award for Album of the Year in 1994. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston’s pursuit in acting didn’t stop there. Aside from her appearance in Disney’s ‘Cinderella,’ she landed leading roles in ‘Waiting to Exhale’ and ‘The Preacher’s Wife.’ ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Whitney’s career contributed to breaking the color barrier that so many African-American artists faced. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On this day we remember her legacy, career, angelic voice, and the contributions she made to the entertainment industry as we know it. Houston left behind her mother, two brothers, and her daughter Bobbi Kristina, who died three years later. ⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀ May Whitney Houston continue to Rest In Peace!
Anaconda, Bailey Jay, and Billboard: Remembering Legendary Singer and
 lcon, Whitney Houston
 @balleralert
Remembering Legendary Singer and Icon, Whitney Houston - blogged by @lanaladonna (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ It’s been six years since the death of legendary singer, actress, producer, and model, WhitneyHouston. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston died at 48 in 2012 after being found unconscious in a bathtub in a Beverly Hills hotel. It was reported that the singer passed due to cocaine use and heart disease. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston’s legacy included winning six Grammys and selling 170 million albums, singles, and videos over her career. Whitney, to this day, is the only artist to chart seven consecutive No. 1 Billboard Hot 100 songs and is the only woman to have two number-one Billboard 200 album awards. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston made her acting debut in “The Bodyguard” in 1992, where she performed the lead single from the film’s soundtrack, ‘I Will Always Love You.’ The song easily became a highlight of Houston’s career, and one of her signature records. It received the Grammy Award for Album of the Year in 1994. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Houston’s pursuit in acting didn’t stop there. Aside from her appearance in Disney’s ‘Cinderella,’ she landed leading roles in ‘Waiting to Exhale’ and ‘The Preacher’s Wife.’ ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Whitney’s career contributed to breaking the color barrier that so many African-American artists faced. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On this day we remember her legacy, career, angelic voice, and the contributions she made to the entertainment industry as we know it. Houston left behind her mother, two brothers, and her daughter Bobbi Kristina, who died three years later. ⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀ May Whitney Houston continue to Rest In Peace!

Remembering Legendary Singer and Icon, Whitney Houston - blogged by @lanaladonna (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ It’s been six years since the death...

Confidence, Future, and Goals: YOU MUST REMAIN A STUDENT OF LIFE. Just like at school, in life we should also aim to succeed. At school our measure of success was grades, in life I would say it is happiness. So how can you be the best possible student of life so that it builds on your happiness levels? Here’s what has worked for me so far. (Yes, your boy millmentor will share his secrets) - 7 ways how being a “student” of life improves your happiness👇 - ✔️Be open minded. An open, positive mindset improves your overall happiness. ✔️Learn something new everyday. Cherish all the different aspects of life that exist. Life is about learning. ✔️Do something you’re afraid of. Courage gives you a real high and positive confidence for the future. ✔️Stay hungry for MORE. Set ambitious goals. You’re happiest when you’re growing. ✔️Take things lightly. When you take things less seriously, you’re much more bound to have fun. ✔️Always remain curious. Always. You’ll find you’ll discover a whole new, exciting world behind curiosity. ✔️Reflect on what’s happening in your life. Knowing how you feel helps you make future decisions that will boost your happiness. - I challenge you to take action on these now and become a happy human being! - Are you going to use these tips? Comment below with your feedback!👇 - life happiness millionairementor
Confidence, Future, and Goals: YOU MUST REMAIN
 A STUDENT OF LIFE.
Just like at school, in life we should also aim to succeed. At school our measure of success was grades, in life I would say it is happiness. So how can you be the best possible student of life so that it builds on your happiness levels? Here’s what has worked for me so far. (Yes, your boy millmentor will share his secrets) - 7 ways how being a “student” of life improves your happiness👇 - ✔️Be open minded. An open, positive mindset improves your overall happiness. ✔️Learn something new everyday. Cherish all the different aspects of life that exist. Life is about learning. ✔️Do something you’re afraid of. Courage gives you a real high and positive confidence for the future. ✔️Stay hungry for MORE. Set ambitious goals. You’re happiest when you’re growing. ✔️Take things lightly. When you take things less seriously, you’re much more bound to have fun. ✔️Always remain curious. Always. You’ll find you’ll discover a whole new, exciting world behind curiosity. ✔️Reflect on what’s happening in your life. Knowing how you feel helps you make future decisions that will boost your happiness. - I challenge you to take action on these now and become a happy human being! - Are you going to use these tips? Comment below with your feedback!👇 - life happiness millionairementor

Just like at school, in life we should also aim to succeed. At school our measure of success was grades, in life I would say it is happiness...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...