About
About

About

With
With

With

First Time
First Time

First Time

Its
Its

Its

Trying
Trying

Trying

Your
Your

Your

Cant Tell
Cant Tell

Cant Tell

The
The

The

But
But

But

That
That

That

🔥 | Latest

cnn.com, Fire, and Memes: U.S: NEWS NEWS UPDATE Feb 15 | A detailed look at the Marjory Stoneman Douglas High School shooting. Yesterday afternoon, 19 year-old Nikolas Cruz opened fire inside Marjory Stoneman Douglas High School in Parkland, Florida. The shooting resulted in 17 fatalities which included students and adults. Cruz is being charged with 17 counts of premeditated murder. ___ The shooting began around 2:40 pm, shortly before school dismissal time. The gunman wore a gas mask into the school, armed with an AR-15 rifle, smoke grenades, and “countless magazines,” officials report. The gunman set off the fire alarm, causing students and teachers to crowd the hallways as he began shooting. He then ducked out of the building by hiding between crowds of students. By the end of the initial shooting rampage, the suspect had killed 12 people inside the school, before killing an additional three outside, including someone standing on the street corner. Two more victims died from their injuries in local hospitals. ___ Nikolas Cruz was arrested in a neighboring city known as Coral Springs just a few miles from the school. Cruz had previously attended Marjory Stoneman Douglas High School, but was expelled for issues that school officials have declined to specify. Other students and members of the school have noted that Nikolas Cruz exhibited “troubling” behavior, and often demonstrated possession of weapons on his social media pages. ___ Since the Sandy Hook school shooting in 2012, there have been at least 239 school shootings nationwide. In these 239 shootings, 438 people were shot, 138 of which died. ___ Jerry News has elected to not share photos of the gunman. ___ Footage - photos: NYT, WSJ, CNN
cnn.com, Fire, and Memes: U.S: NEWS
 NEWS UPDATE
 Feb 15 | A detailed look at the Marjory
 Stoneman Douglas High School shooting.
Yesterday afternoon, 19 year-old Nikolas Cruz opened fire inside Marjory Stoneman Douglas High School in Parkland, Florida. The shooting resulted in 17 fatalities which included students and adults. Cruz is being charged with 17 counts of premeditated murder. ___ The shooting began around 2:40 pm, shortly before school dismissal time. The gunman wore a gas mask into the school, armed with an AR-15 rifle, smoke grenades, and “countless magazines,” officials report. The gunman set off the fire alarm, causing students and teachers to crowd the hallways as he began shooting. He then ducked out of the building by hiding between crowds of students. By the end of the initial shooting rampage, the suspect had killed 12 people inside the school, before killing an additional three outside, including someone standing on the street corner. Two more victims died from their injuries in local hospitals. ___ Nikolas Cruz was arrested in a neighboring city known as Coral Springs just a few miles from the school. Cruz had previously attended Marjory Stoneman Douglas High School, but was expelled for issues that school officials have declined to specify. Other students and members of the school have noted that Nikolas Cruz exhibited “troubling” behavior, and often demonstrated possession of weapons on his social media pages. ___ Since the Sandy Hook school shooting in 2012, there have been at least 239 school shootings nationwide. In these 239 shootings, 438 people were shot, 138 of which died. ___ Jerry News has elected to not share photos of the gunman. ___ Footage - photos: NYT, WSJ, CNN

Yesterday afternoon, 19 year-old Nikolas Cruz opened fire inside Marjory Stoneman Douglas High School in Parkland, Florida. The shooting res...

Advice, Future, and Ironic: eggrollie art has been hard lately but i made this banana today and its probably the height of my ability and i am ready novw a guest speaker in one of my classes recently gave some of the best advice I have ever received… 1. let curiosity be your compass - think about what you’re motivated to do, your affinity, your aspirations. what are the core reasons for your motivation? 2. impact is everything - if everything works out exactly as expected, why does it matter? what will you learn or change? 3. be James Bond - expose the side of yourself that will be received best. you don’t need to reveal everything about yourself upfront. 4. create strong partnerships - build a wise council. you only need three people: one who is a few steps ahead of you or where you want to be in the future, one who is progressing at the same pace as you, and one who is behind you but has experienced more. 5. to make space for what matters, you have to say no - we aren’t self-aware enough to know our breaking point before we reach it, so don’t be afraid to pass on some things. 6. create meaningful time - bingeing is not productive. establish clear morning rituals and practice contingency management. a slow and steady schedule is best. 7.when you rush from A to B, you miss everything in between - slow down and forget about your destination. take time to appreciate the path you’re on. 8.”the chief enemy of creativity is good sense” - be creative. just don’t lose touch with your common sense. 9.it’s supposed to be fun most of the time or something’s wrong - there will be spontaneous emotional breakdowns and seemingly impassible obstacles, but enjoy the journey of life billsimportantposts
Advice, Future, and Ironic: eggrollie
 art has been hard lately but i made this banana today and its probably the
 height of my ability and i am ready novw
a guest speaker in one of my classes recently gave some of the best advice I have ever received… 1. let curiosity be your compass - think about what you’re motivated to do, your affinity, your aspirations. what are the core reasons for your motivation? 2. impact is everything - if everything works out exactly as expected, why does it matter? what will you learn or change? 3. be James Bond - expose the side of yourself that will be received best. you don’t need to reveal everything about yourself upfront. 4. create strong partnerships - build a wise council. you only need three people: one who is a few steps ahead of you or where you want to be in the future, one who is progressing at the same pace as you, and one who is behind you but has experienced more. 5. to make space for what matters, you have to say no - we aren’t self-aware enough to know our breaking point before we reach it, so don’t be afraid to pass on some things. 6. create meaningful time - bingeing is not productive. establish clear morning rituals and practice contingency management. a slow and steady schedule is best. 7.when you rush from A to B, you miss everything in between - slow down and forget about your destination. take time to appreciate the path you’re on. 8.”the chief enemy of creativity is good sense” - be creative. just don’t lose touch with your common sense. 9.it’s supposed to be fun most of the time or something’s wrong - there will be spontaneous emotional breakdowns and seemingly impassible obstacles, but enjoy the journey of life billsimportantposts

a guest speaker in one of my classes recently gave some of the best advice I have ever received… 1. let curiosity be your compass - think ab...

Confidence, Energy, and Friends: ASPIRE TO INSPIRE BEFOR WE EXPIRE Has anyone ever inspired you to change your life in a significant way that made you healthier, happier, or more fulfilled? If so, you understand the difference that positive inspiration can make in a person’s life. - 👀Would you like to know the simplest ways to inspire people and change their lives?👇 ✔️Care. If you can’t show a person that you genuinely care about them, do you think you will be able to inspire them? The answer is a resounding, “NO!” Show people you care in your words (“How are you today?”) and your actions (small acts of kindness go a long way). ✔️Be enthusiastic. The saying “enthusiasm is contagious” is common enough to be cliché, but it’s a cliché because it’s true. Reflect enthusiasm every day to the people you are in contact with and I’m willing to wager your genuine smiles, positive energy, and caring concern will be returned ten-fold. ✔️Earn trust. If a person you know and love tells you a secret, it stays between you and them. Trust takes a long time to build, but it can be destroyed overnight, so don’t take part in workplace gossip or unnecessary drama in your social networks so you can be a positive influence that people are unafraid to talk to. ✔️Reach for the stars. No one will be inspired by a person who resigns themselves to “reality” (such a dreadful place that sounds devoid of hope or personal growth in my opinion). Be ambitious, aim high, and never surrender if you want to inspire people that they, too, can accomplish anything they set their mind to. ✔️Stay true to who you are. A lot of us have a variety of “selves” that come out depending on the social situation: home, work, and friends all require a different song-and-dance. But putting on a different show for every group of people you encounter is super exhausting, and it’s certainly not a good way to inspire people around you. Would you place your confidence in a person who was so uncomfortable in their personality that they felt the need to pander to whatever crowd they were with? Embrace your true self without apology. - aspire inspire success live millionairementor
Confidence, Energy, and Friends: ASPIRE TO
 INSPIRE BEFOR
 WE EXPIRE
Has anyone ever inspired you to change your life in a significant way that made you healthier, happier, or more fulfilled? If so, you understand the difference that positive inspiration can make in a person’s life. - 👀Would you like to know the simplest ways to inspire people and change their lives?👇 ✔️Care. If you can’t show a person that you genuinely care about them, do you think you will be able to inspire them? The answer is a resounding, “NO!” Show people you care in your words (“How are you today?”) and your actions (small acts of kindness go a long way). ✔️Be enthusiastic. The saying “enthusiasm is contagious” is common enough to be cliché, but it’s a cliché because it’s true. Reflect enthusiasm every day to the people you are in contact with and I’m willing to wager your genuine smiles, positive energy, and caring concern will be returned ten-fold. ✔️Earn trust. If a person you know and love tells you a secret, it stays between you and them. Trust takes a long time to build, but it can be destroyed overnight, so don’t take part in workplace gossip or unnecessary drama in your social networks so you can be a positive influence that people are unafraid to talk to. ✔️Reach for the stars. No one will be inspired by a person who resigns themselves to “reality” (such a dreadful place that sounds devoid of hope or personal growth in my opinion). Be ambitious, aim high, and never surrender if you want to inspire people that they, too, can accomplish anything they set their mind to. ✔️Stay true to who you are. A lot of us have a variety of “selves” that come out depending on the social situation: home, work, and friends all require a different song-and-dance. But putting on a different show for every group of people you encounter is super exhausting, and it’s certainly not a good way to inspire people around you. Would you place your confidence in a person who was so uncomfortable in their personality that they felt the need to pander to whatever crowd they were with? Embrace your true self without apology. - aspire inspire success live millionairementor

Has anyone ever inspired you to change your life in a significant way that made you healthier, happier, or more fulfilled? If so, you unders...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Ass, Fucking, and Funny: I had to read this at work today and it's the funniest thing ever @ theblessedone TO ALL EMPLOYEES It has been brought to the management's attention that some individuals have been using foul lanquage in the course of normal conversation between employees. Due to complaints from some of the easily offended workers, this conduct will no longer be tolerated The management does, however, realise the importance of each person being able to properly express their feelings when communicating with their fellow employees. Therefore, the management has compiled the following code phrases so that the proper exchange of ideas and information can continue. OLD PHRASE NEW PHRASE I'm not certain that's feasible. No fucking way You've got to be shitting me.Really Tell someone who gives a fuck Ask me if I give a fuck It's not my fucking problem. ....Perhaps you should check with <name> Of course I'm concerned. I wasn't involved in that project. . What the fuck? Fuck it, it won't work.ans Why the fuck didn't you tell me that sooner?.... I'll try to schedule that nteresting behaviour . I'm not sure I can implement this. When the fuck do you expect me to do this ?....Perhaps I can work late Who the fuck cares?. Are you sure it's a problem? He's got his head up his ass.. Eat shit. Eat shit and die Eat shit and die, motherfucker... What the fuck do they want from my life?They weren't happy with it? He's not familiar with the problem. You don't say Excuse me? Excuse me, <sir or ma'am>? Kiss my asS. Fuck it, I'm on salary So you'd like my help with that? I can’t believe some of you don’t follow @funny 🤣
Ass, Fucking, and Funny: I had to read this at work today and it's
 the funniest thing ever
 @ theblessedone
 TO ALL EMPLOYEES
 It has been brought to the management's attention that some individuals have been using foul lanquage in
 the course of normal conversation between employees. Due to complaints from some of the easily
 offended workers, this conduct will no longer be tolerated
 The management does, however, realise the importance of each person being able to properly express
 their feelings when communicating with their fellow employees. Therefore, the management has compiled
 the following code phrases so that the proper exchange of ideas and information can continue.
 OLD PHRASE
 NEW PHRASE
 I'm not certain that's feasible.
 No fucking way
 You've got to be shitting me.Really
 Tell someone who gives a fuck
 Ask me if I give a fuck
 It's not my fucking problem.
 ....Perhaps you should check with <name>
 Of course I'm concerned.
 I wasn't involved in that project.
 .
 What the fuck?
 Fuck it, it won't work.ans
 Why the fuck didn't you tell me that sooner?.... I'll try to schedule that
 nteresting behaviour
 . I'm not sure I can implement this.
 When the fuck do you expect me to do this ?....Perhaps I can work late
 Who the fuck cares?.
 Are you sure it's a problem?
 He's got his head up his ass..
 Eat shit.
 Eat shit and die
 Eat shit and die, motherfucker...
 What the fuck do they want from my life?They weren't happy with it?
 He's not familiar with the problem.
 You don't say
 Excuse me?
 Excuse me, <sir or ma'am>?
 Kiss my asS.
 Fuck it, I'm on salary
 So you'd like my help with that?
I can’t believe some of you don’t follow @funny 🤣

I can’t believe some of you don’t follow @funny 🤣

Drugs, Family, and Herpes: Jim Carrey Cleared In Wrongful Death Lawsuit Filed By Mother and Ex-Husband of ona Whte @balleralert Jim Carrey Cleared In Wrongful Death Lawsuit Filed By Mother and Ex-Husband of Cathriona White - blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ After years of back and forth between JimCarrey and the family of his ex-girlfriend CathrionaWhite, the actor has officially been cleared of any wrongdoing in connection to White’s death. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to Daily Mail, Carrey had been in a legal battle with White’s estranged mother and her ex-husband after the two accused the actor of giving White the drugs she used to commit suicide in 2015. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The duo used a series of medical records and personal notes and letters to prove their claims that Carrey drove their loved-one to suicide. Aside from providing White with drugs, Carrey was accused of giving the woman herpes. However, the actor’s legal team was able to debunk those claims with texts messages that proved White forged her medical records in an extortion plot for “millions of dollars” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Now though, after a longstanding legal battle, Carrey has scored a win in the wrongful death case against him. According to the Hollywood Reporter, a rep for the actor confirmed the case was dismissed on Jan. 25, but refused to further comment on the matter.
Drugs, Family, and Herpes: Jim Carrey Cleared In Wrongful Death
 Lawsuit Filed By Mother and Ex-Husband of
 ona Whte @balleralert
Jim Carrey Cleared In Wrongful Death Lawsuit Filed By Mother and Ex-Husband of Cathriona White - blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ After years of back and forth between JimCarrey and the family of his ex-girlfriend CathrionaWhite, the actor has officially been cleared of any wrongdoing in connection to White’s death. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to Daily Mail, Carrey had been in a legal battle with White’s estranged mother and her ex-husband after the two accused the actor of giving White the drugs she used to commit suicide in 2015. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The duo used a series of medical records and personal notes and letters to prove their claims that Carrey drove their loved-one to suicide. Aside from providing White with drugs, Carrey was accused of giving the woman herpes. However, the actor’s legal team was able to debunk those claims with texts messages that proved White forged her medical records in an extortion plot for “millions of dollars” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Now though, after a longstanding legal battle, Carrey has scored a win in the wrongful death case against him. According to the Hollywood Reporter, a rep for the actor confirmed the case was dismissed on Jan. 25, but refused to further comment on the matter.

Jim Carrey Cleared In Wrongful Death Lawsuit Filed By Mother and Ex-Husband of Cathriona White - blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ After ...