yours
yours

yours

comming
comming

comming

leaving
leaving

leaving

gagging
gagging

gagging

gagged
gagged

gagged

gag
gag

gag

computing
computing

computing

they
they

they

com
com

com

 | Latest

Computers, Life, and Siri: Todd Howard (video game designer) From Wikipedia, the free encyclopedia Todd Howard is an American video game designer, director, and producer. He currently serves as director and executive producer at Bethesda Game Studios, where he has led the development of the Fallout and The Elder Scrolls series. GamePro magazine named Howard one of the "Top 20 Most Influential People in Gaming" over the last 20 years, 1 He was named one of IGN's "Top Game Creators of All Time"2 Todd Howard Contents Early life 2 Career 2.1 Bethesda Softworks 2.2 Speaker 3 Awards and recognition 4 References 5 External links Early life Howard was born in Lower Macungie Township, Pennsylvania. He developed an interest in computers, particularly video games, at a Howard in 2010 This article is semi-protected until April 25, 2018, due to vandalism <p><a href="http://serketssecret.tumblr.com/post/173240250914/vvarhound-lesbianrey-hey-siri-add-to-calendar" class="tumblr_blog">serketssecret</a>:</p> <blockquote> <p><a href="http://vvarhound.tumblr.com/post/172807764340/lesbianrey-hey-siri-add-to-calendar-vandalize" class="tumblr_blog">vvarhound</a>:</p> <blockquote> <p><a href="http://lesbianrey.tumblr.com/post/164298174870/hey-siri-add-to-calendar-vandalize-todd-howards" class="tumblr_blog">lesbianrey</a>:</p> <blockquote><p>hey siri add to calendar vandalize todd howards wikipedia page on april 25th, 2018</p></blockquote> <p>the day approaches</p> </blockquote> <figure data-orig-width="600" data-orig-height="451" class="tmblr-full"><img src="https://78.media.tumblr.com/1f1f0162eca392685823815a0fd84d76/tumblr_inline_p7nlyqjFya1qgka3a_540.jpg" alt="image" data-orig-width="600" data-orig-height="451"/></figure></blockquote>

<p><a href="http://serketssecret.tumblr.com/post/173240250914/vvarhound-lesbianrey-hey-siri-add-to-calendar" class="tumblr_blog">serketssecr...

Books, Computers, and Facebook: "This teacher deserves an award. He was teaching about Microsoft Word without...you know, computer." SCROLL BAK <p><a href="http://christiancgtomas.tumblr.com/post/172388454903/funnyjoke-respect-funny-memes-updated" class="tumblr_blog">christiancgtomas</a>:</p> <blockquote> <p><a href="https://funny.in/post/172311565383/respect-funny-memes-updated-daily" class="tumblr_blog">funnyjoke</a>:</p> <blockquote> <p>RESPECT </p> <p>Funny Memes. Updated Daily! FunnyJoke.tumblr.com </p> </blockquote> <h2><a href="https://www.npr.org/sections/goatsandsoda/2018/03/01/589519475/computer-teacher-with-no-computers-chalks-up-clever-classroom-plan">His name is Owura Kwadwo Hottish of Ghana.</a></h2> <p>He has been teaching about computers for six years, but without actual computers to provide for his students, he illustrates for them on a chalkboard. He learned art and graphic design in secondary school and puts it to use with every lesson, and besides Microsoft Word, he teaches his students basic components.</p> <figure data-orig-width="988" data-orig-height="1416" class="tmblr-full"><img src="https://78.media.tumblr.com/e4886c93943a9eff1fcf3f23eba55fc9/tumblr_inline_p6ddywA5OD1rxr8yp_540.png" alt="image" data-orig-width="988" data-orig-height="1416"/></figure><p><br/><br/>When asked about thedigital divide he said this in the above interview:</p> <figure data-orig-width="1326" data-orig-height="346" class="tmblr-full"><img src="https://78.media.tumblr.com/4560f06c7e611a9080a66c6c7e2f7a7b/tumblr_inline_p6dducroMT1rxr8yp_540.png" alt="image" data-orig-width="1326" data-orig-height="346"/></figure><h2><i>They are lacking more than just equipment.</i> </h2> <p><a href="https://www.indy100.com/article/owura-kwadwo-facebook-post-ghana-village-school-microsoft-word-blackboard-8229011">Since going viral, however, there have been several benefactors who helped him AND his students.</a>Including being sent to the Microsoft Certified Educator (MCE) program for professional development, and being equipped with an actual device.</p> <figure data-orig-width="1000" data-orig-height="1340" class="tmblr-full"><img src="https://78.media.tumblr.com/88fd7b2a39a4905a4766a9d469c5ed0e/tumblr_inline_p6de16uQeL1rxr8yp_540.png" alt="image" data-orig-width="1000" data-orig-height="1340"/></figure><p>His classroom even received a couple of laptops, books, and five desktop computers from other schools and universities!</p> <figure data-orig-width="988" data-orig-height="1390" class="tmblr-full"><img src="https://78.media.tumblr.com/28cb887f90b13149713b5c99450666b7/tumblr_inline_p6de4d3z9c1rxr8yp_540.png" alt="image" data-orig-width="988" data-orig-height="1390"/></figure></blockquote> <p>This is so happy </p>

<p><a href="http://christiancgtomas.tumblr.com/post/172388454903/funnyjoke-respect-funny-memes-updated" class="tumblr_blog">christiancgtomas...

Best Buy, Computers, and Doctor: FBl Has Been Working with Best Buy's Geek Squad to Crack Down on Child Porn Found on People's Computers @balleralert EST BUY FBI Has Been Working with Best Buys Geek Squad to Crack Down on Child Porn Found on People's Computers-blogged by @thereal__bee According to reports, the FBI has been working with Best Buys Geek Squad computer repairmen for almost a decade. The FBI reportedly paid the employees to flag and disclose illegal content that they found on peoples computers, specifically in reference to child pornography. According to the Electronic Frontier Foundations account, if a Geek Squad employee finds potentially illegal content on a computer during inspection, they are to contact the FBI and notify them. The agents then review the content, if it is illegal, they then seize the device. In at least one incident, the FBI reportedly paid a Geek Squad employee $500 for reporting illegal content. They then proceeded to use him as an informant. After the prosecution of a California doctor for child abuse imagery found on his computer, the EFF filed a Freedom of Information request to get more knowledge about the extent of the relationship between Geel Squad employers and the FBI. According to reports, the results show that it circumvents computer owners Fourth Amendment rights. Best Buy insists that they have a moral, and sometimes, legal, obligation to report these findings to law enforcement, as they are helping discover and thwart illegal, abusive behavior, reports Buzzfeed. However, the retailer assures consumers that they do not actively seek out illegal material and that employees have not received training from law enforcement to learn how to find it, reports Fortune.com

FBI Has Been Working with Best Buys Geek Squad to Crack Down on Child Porn Found on People's Computers-blogged by @thereal__bee ...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and Im REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells dont actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But heres the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesnt really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at sequencing DNA letter by letter, it is possible for you to learn how your DNA may differ from the persons next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we havent quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, its important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Cars, College, and Community: October 19 at 11:11ame In highschool I wonder why they pushed college on us so hard instead of trades? They didn't tell me union plumbers can make $1,600 a week with no OT and NO DEGREE....or that truck drivers can make 6 bands a week if they buy their own truck w/NO DEGREE? OR that traveling welders can make 100k a year with NO DEGREE.they made it seem like college was the only way to be successful Like Comment Share nd 352 others 495 Shares I'm a weld Inspector, traveling inspectors can make 6 figures easy Oct 19 at 11:14am Love 2 Reply Delete plied- 3 replies That's awesome bro I'm a truck driver and we can make 6 figures as well with the right company. I just wonder why they ain't tell me about this shit in highschool. They made it seem like college was the only way Oct 19 at 11:16am Edited Like 3 Reply More <p><a href="https://triggeredmedia.tumblr.com/post/169276755942/dedicating-ruckus-rtrixie-triggeredmedia" class="tumblr_blog">triggeredmedia</a>:</p> <blockquote><p><a href="https://dedicating-ruckus.tumblr.com/post/169276064463/rtrixie-triggeredmedia-its-almost-as-if" class="tumblr_blog">dedicating-ruckus</a>:</p><blockquote> <p><a href="http://rtrixie.tumblr.com/post/169275885979/triggeredmedia-its-almost-as-if-schools-push" class="tumblr_blog">rtrixie</a>:</p> <blockquote> <p><a href="https://triggeredmedia.tumblr.com/post/169270049767/its-almost-as-if-schools-push-and-ideology-that" class="tumblr_blog">triggeredmedia</a>:</p> <blockquote><p>Its almost as if schools push and ideology that benefits schools.</p></blockquote> <p>Trades are a valid option and theres absolutely no shame in admitting that you cant afford college.</p> </blockquote> <p style="">The modern push of College For All has only really served to bankrupt a lot of people who didnt need it, and water down the degree for those who did.<br/></p> </blockquote><p>I honestly believe thats part of the agenda of the left. Their entire platform is around the government taking care of you. </p><p>You should do what you want. If thats feminist dance study so be it. Oh you cant take care of your family now? Proof we need more government. </p><p>There are over 6 million open jobs right now in this country. Two-thirds of jobs in this country dont require any sort of degree. </p><p>This is where left is usually respond with but automation as proof that theres not going to be any jobs. </p><p>Thats exactly what they said when cars and were invented in horse carriage and farming was changed.</p><p>Thats what they said when computers replace most office workers.</p><p>We have more jobs now with more technology and more automation. Theyre just different jobs. </p></blockquote> <p>They obviously pushed it to funnel more money into the money pit that is student loans. I need a degree for the things I want to do, but I wish I had gone about it a different way. Right now my sister is taking part high school classes and part cosmetology classes at a community college. By the time she goes to a real college she should be able to go as a junior and save tons of money. Kids if youre still in high school listen to me: dont let anybody tell you you absolutely have to go to a four-year school you cant afford just to be successful. Dont let anybody talk you into taking out $50,000+ in loans that youll never be able to pay back. Consider your options, look at community college offerings and dual enrollment and online credits. We have more ways than ever to get a well-rounded education and qualifications for the things we need to do.</p>

<p><a href="https://triggeredmedia.tumblr.com/post/169276755942/dedicating-ruckus-rtrixie-triggeredmedia" class="tumblr_blog">triggeredmedia...

Click, Computers, and Dating: Slow Computer? DON'T WORRY A Little About Me For secruity purposes I cannot reveal my name. I was an employee at Microsoft for nearly 10 years. My team and I worked on new and innovative ways to combat hackers and viruses alike. It was while working here thaft my team discovered this technique and even presented to Steve Balmer (CEO at the time) himself. Sadly this news would make Microsoft's sister companies (e.g. AVG) obselete ME Will this work for me? If you are running any version of Microsoft Windows dating back to 1995 this will work! This includes, but is not limited to, the following: Microsoft "Windows95 Windows98 WindowsX9 Windows Vistar Windows7 Windows 8 What do I have to do? Follow these steps. Step 1: Open up Notepad Click Start, click Run..., type in "notepad" (without the quotes) and press OK. Step 2: Creating the Code Type the following code into Notepad Step 3: Saving Program Click File, then click Save As Save it to your Desktop so it's easy to find Save it as SpeedUp.bat Other names are fine, but make sure it ends with the extension: bat h Deskoop @echo off del C:Windowslsystem32 Run Oganize New folde Type the name of a program, folder, document, or Internet resourcS e, and Windows will open it for you. Open: Make sure this is set to All Files Make sure you type it as shown (being sure to press Enter after the word "off) OK Cancel Browse... Sve astspe AlFles Encading: ANS v Finally click Save What does it do? Microsoft has been building off the previous Windows' code for years which makes it easily hackable. This is why they are constantly pushing out updates and patches. The real solution is to keep the new code and remove the old one. That's why this code deletes "system32" folder (which is all the code from when computers were 32bit, hence its name). Be sure to delete that folder and not Windows!! Step 4: Run Your Program Locate your file and double click it. You might notice a quick black box pop up This means it worked Step 5: Restart Restart your computer. This allows Windows to clean itself up That's it! SpeedUp Special Thanks To the Pool Team over at Microsoft's central office in Vedbaek, Denmark! I miss you guys! <h2>Trucazo para mejorar el rendimiento de vuestro Windows.</h2><p>En serio, no lo hag獺is, o s穩, no s矇, no soy hinjeniero, o s穩&hellip;</p>

<h2>Trucazo para mejorar el rendimiento de vuestro Windows.</h2><p>En serio, no lo hag獺is, o s穩, no s矇, no soy hinjeniero, o s穩&hellip;</p>