yours
yours

yours

comming
comming

comming

leaving
leaving

leaving

gagging
gagging

gagging

gagged
gagged

gagged

gag
gag

gag

computing
computing

computing

they
they

they

com
com

com

🤖
🤖

🤖

🔥 Popular | Latest

Bodies , Brains, and Click: interstellardragon: curlicuecal: hopeology: andreajmars: hopeology: thebuttkingpost: wheel-skellington: crocutalupus: x why this dog look like an nvidia tech demo High spec animal Oh, I KNOW WHY! Rare video game tech knowledge to the rescue! Animation of fur is really really hard, it’s effectively trying to animate, in real time, a few billion little strings. Noone can do that. Most consumer gaming computers would just burst into flame so that isn’t something people will do when modeling fur or hair. Instead, what animators and 3D modelers do in order to get around this is they form the fur into many layers of sheets or interlocking flexible bodies. Notice this animal has stiff fur, matted maybe from sweat or water. So when we watch the fur move our eyes and brains notice something we don’t notice on purpose. The fur isn’t moving individually, it’s moving in sheets and flexible bodies. There’s some slight movement and flexing, but it’s not “fur” like our brains want it to be, it’s “fur” in the way that fur is commonly animated! layers and flexible sheets! Also, light angles like this are common in animation to show the light being calculated across the body when it moves, so it looks familiar in the angle of the light too! BLESS YOU I don’t think I’ve ever gotten such an excited happy reply to an info dump hehehe oh cool i found someone explaining the thing Lmao fun explanation but if anyone bothered to click the source, op already explained that it’s a real hyena clip with the frame rate slowed down. That… Doesn’t negate the explanation? At all? They weren’t saying it wasn’t a real photo, they were saying that the way the fur is matted contributes to the animated appearance.
Being Alone, College, and Computers: Philadelphia NEWS . RESTAURANTS HEALTH- WE G SITI[+ REAL ESIATE & HEUE· 1HINGS 10 De- 酉EDDING- BEST 0F PEILLY MAGAZINE Q Besides, the impetus seemed righteous. In a world torn asunder by the Great Depression, the Holocaust, and two World Wars, our citizenry needed to come together, be united, rally behind a collective vision of what it meant to be an American: You lived in a single-family house. you drove a station wagon, you wore bowling shirts and blue jeans, and you slathered mayonnaise on everything from BLTs to burgers to pastrami on rye. How do you think "Hold the mayo" became a saying? There was aluays mayo, and if you were some kind of deviant who didn't want it, you had to say so out loud MY SON İAKE, who's 25, eats mayo. He's a practical young man who works in computers and adores macaroni salad. He's a good son. I also have a daughter. She was a women's and gender studies major in college. Naturally, she loathes mayonnaise. And she's not alone. Ask the young people you know their opinion of mayo, and you'll be shocked by the depths of their emotion. Oh, there's the occasional outlier, like Jake. But for the most part, today's youth would sooner get their news from an actual paper newspaper than ingest mayonnaise The origins of this contentious condiment are hotly debated. Is its name derived from the city of Mahon on the Balearic Island of Menorca, where the Duc de Richelieu's chef, unable to find cream for a sauce to celebrate his lordship's successful siege during the Seven Years War, substituted an emulsion of eggs and ol? Or is it a bastardization of Bayonnaise, fronm polyglotplatypus:please listen to this poor man losing his shit as he reads an article blaming millenials for killing the mayonnaise industry that was written by a babyboomer upset people don’t want to eat her bland salads anymore
Being Alone, College, and Computers: Philadelphia NEWS . RESTAURANTS HEALTH- WE G SITI[+ REAL ESIATE & HEUE· 1HINGS 10 De- 酉EDDING- BEST 0F PEILLY MAGAZINE Q Besides, the impetus seemed righteous. In a world torn asunder by the Great Depression, the Holocaust, and two World Wars, our citizenry needed to come together, be united, rally behind a collective vision of what it meant to be an American: You lived in a single-family house. you drove a station wagon, you wore bowling shirts and blue jeans, and you slathered mayonnaise on everything from BLTs to burgers to pastrami on rye. How do you think "Hold the mayo" became a saying? There was aluays mayo, and if you were some kind of deviant who didn't want it, you had to say so out loud MY SON İAKE, who's 25, eats mayo. He's a practical young man who works in computers and adores macaroni salad. He's a good son. I also have a daughter. She was a women's and gender studies major in college. Naturally, she loathes mayonnaise. And she's not alone. Ask the young people you know their opinion of mayo, and you'll be shocked by the depths of their emotion. Oh, there's the occasional outlier, like Jake. But for the most part, today's youth would sooner get their news from an actual paper newspaper than ingest mayonnaise The origins of this contentious condiment are hotly debated. Is its name derived from the city of Mahon on the Balearic Island of Menorca, where the Duc de Richelieu's chef, unable to find cream for a sauce to celebrate his lordship's successful siege during the Seven Years War, substituted an emulsion of eggs and ol? Or is it a bastardization of Bayonnaise, fronm polyglotplatypus:please listen to this poor man losing his shit as he reads an article blaming millenials for killing the mayonnaise industry that was written by a babyboomer upset people don’t want to eat her bland salads anymore
Being Alone, College, and Computers: Philadelphia NEWS . RESTAURANTS HEALTH- WE G SITI[+ REAL ESIATE & HEUE· 1HINGS 10 De- 酉EDDING- BEST 0F PEILLY MAGAZINE Q Besides, the impetus seemed righteous. In a world torn asunder by the Great Depression, the Holocaust, and two World Wars, our citizenry needed to come together, be united, rally behind a collective vision of what it meant to be an American: You lived in a single-family house. you drove a station wagon, you wore bowling shirts and blue jeans, and you slathered mayonnaise on everything from BLTs to burgers to pastrami on rye. How do you think "Hold the mayo" became a saying? There was aluays mayo, and if you were some kind of deviant who didn't want it, you had to say so out loud MY SON İAKE, who's 25, eats mayo. He's a practical young man who works in computers and adores macaroni salad. He's a good son. I also have a daughter. She was a women's and gender studies major in college. Naturally, she loathes mayonnaise. And she's not alone. Ask the young people you know their opinion of mayo, and you'll be shocked by the depths of their emotion. Oh, there's the occasional outlier, like Jake. But for the most part, today's youth would sooner get their news from an actual paper newspaper than ingest mayonnaise The origins of this contentious condiment are hotly debated. Is its name derived from the city of Mahon on the Balearic Island of Menorca, where the Duc de Richelieu's chef, unable to find cream for a sauce to celebrate his lordship's successful siege during the Seven Years War, substituted an emulsion of eggs and ol? Or is it a bastardization of Bayonnaise, fronm ouyangdan: negamewtwo: polyglotplatypus: please listen to this poor man losing his shit as he reads an article blaming millenials for killing the mayonnaise industry that was written by a babyboomer upset people don’t want to eat her bland salads anymore PLEASE TURN THE SOUND ON OH MY GOD
Computers, Life, and Siri: Todd Howard (video game designer) From Wikipedia, the free encyclopedia Todd Howard is an American video game designer, director, and producer. He currently serves as director and executive producer at Bethesda Game Studios, where he has led the development of the Fallout and The Elder Scrolls series. GamePro magazine named Howard one of the "Top 20 Most Influential People in Gaming" over the last 20 years, 1 He was named one of IGN's "Top Game Creators of All Time"2 Todd Howard Contents Early life 2 Career 2.1 Bethesda Softworks 2.2 Speaker 3 Awards and recognition 4 References 5 External links Early life Howard was born in Lower Macungie Township, Pennsylvania. He developed an interest in computers, particularly video games, at a Howard in 2010 This article is semi-protected until April 25, 2018, due to vandalism <p><a href="http://serketssecret.tumblr.com/post/173240250914/vvarhound-lesbianrey-hey-siri-add-to-calendar" class="tumblr_blog">serketssecret</a>:</p> <blockquote> <p><a href="http://vvarhound.tumblr.com/post/172807764340/lesbianrey-hey-siri-add-to-calendar-vandalize" class="tumblr_blog">vvarhound</a>:</p> <blockquote> <p><a href="http://lesbianrey.tumblr.com/post/164298174870/hey-siri-add-to-calendar-vandalize-todd-howards" class="tumblr_blog">lesbianrey</a>:</p> <blockquote><p>hey siri add to calendar ‘vandalize todd howard’s wikipedia page’ on april 25th, 2018</p></blockquote> <p>the day approaches</p> </blockquote> <figure data-orig-width="600" data-orig-height="451" class="tmblr-full"><img src="https://78.media.tumblr.com/1f1f0162eca392685823815a0fd84d76/tumblr_inline_p7nlyqjFya1qgka3a_540.jpg" alt="image" data-orig-width="600" data-orig-height="451"/></figure></blockquote>

serketssecret: vvarhound: lesbianrey: hey siri add to calendar ‘vandalize todd howard’s wikipedia page’ on april 25th, 2018 the day approa...

Books, Computers, and Facebook: "This teacher deserves an award. He was teaching about Microsoft Word without...you know, computer." SCROLL BAK <p><a href="http://christiancgtomas.tumblr.com/post/172388454903/funnyjoke-respect-funny-memes-updated" class="tumblr_blog">christiancgtomas</a>:</p> <blockquote> <p><a href="https://funny.in/post/172311565383/respect-funny-memes-updated-daily" class="tumblr_blog">funnyjoke</a>:</p> <blockquote> <p>RESPECT 👏👏💪</p> <p>Funny Memes. Updated Daily! ⇢ FunnyJoke.tumblr.com 😀</p> </blockquote> <h2><a href="https://www.npr.org/sections/goatsandsoda/2018/03/01/589519475/computer-teacher-with-no-computers-chalks-up-clever-classroom-plan">His name is Owura Kwadwo Hottish of Ghana.</a></h2> <p>He has been teaching about computers for six years, but without actual computers to provide for his students, he illustrates for them on a chalkboard. He learned art and graphic design in secondary school and puts it to use with every lesson, and besides Microsoft Word, he teaches his students basic components.</p> <figure data-orig-width="988" data-orig-height="1416" class="tmblr-full"><img src="https://78.media.tumblr.com/e4886c93943a9eff1fcf3f23eba55fc9/tumblr_inline_p6ddywA5OD1rxr8yp_540.png" alt="image" data-orig-width="988" data-orig-height="1416"/></figure><p><br/><br/>When asked about the “digital divide” he said this in the above interview:</p> <figure data-orig-width="1326" data-orig-height="346" class="tmblr-full"><img src="https://78.media.tumblr.com/4560f06c7e611a9080a66c6c7e2f7a7b/tumblr_inline_p6dducroMT1rxr8yp_540.png" alt="image" data-orig-width="1326" data-orig-height="346"/></figure><h2>“<i>They are lacking more than just equipment.”</i> </h2> <p><a href="https://www.indy100.com/article/owura-kwadwo-facebook-post-ghana-village-school-microsoft-word-blackboard-8229011">Since going viral, however, there have been several benefactors who helped him AND his students.</a> Including being sent to the Microsoft Certified Educator (MCE) program for professional development, and being equipped with an actual device.</p> <figure data-orig-width="1000" data-orig-height="1340" class="tmblr-full"><img src="https://78.media.tumblr.com/88fd7b2a39a4905a4766a9d469c5ed0e/tumblr_inline_p6de16uQeL1rxr8yp_540.png" alt="image" data-orig-width="1000" data-orig-height="1340"/></figure><p>His classroom even received a couple of laptops, books, and five desktop computers from other schools and universities!</p> <figure data-orig-width="988" data-orig-height="1390" class="tmblr-full"><img src="https://78.media.tumblr.com/28cb887f90b13149713b5c99450666b7/tumblr_inline_p6de4d3z9c1rxr8yp_540.png" alt="image" data-orig-width="988" data-orig-height="1390"/></figure></blockquote> <p>This is so happy 😄</p>

christiancgtomas: funnyjoke: RESPECT 👏👏💪 Funny Memes. Updated Daily! ⇢ FunnyJoke.tumblr.com 😀 His name is Owura Kwadwo Hottish of Ghana....

Best Buy, Computers, and Doctor: FBl Has Been Working with Best Buy's Geek Squad to Crack Down on Child Porn Found on People's Computers @balleralert EST BUY FBI Has Been Working with Best Buy’s Geek Squad to Crack Down on Child Porn Found on People's Computers-blogged by @thereal__bee ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ According to reports, the FBI has been working with Best Buy’s Geek Squad computer repairmen for almost a decade. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ The FBI reportedly paid the employees to flag and disclose illegal content that they found on people’s computers, specifically in reference to child pornography. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ According to the Electronic Frontier Foundation’s account, if a Geek Squad employee finds potentially illegal content on a computer during inspection, they are to contact the FBI and notify them. The agents then review the content, if it is illegal, they then seize the device. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ In at least one incident, the FBI reportedly paid a Geek Squad employee $500 for reporting illegal content. They then proceeded to use him as an informant. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ After the prosecution of a California doctor for child abuse imagery found on his computer, the EFF filed a Freedom of Information request to get more knowledge about the extent of the relationship between Geel Squad employers and the FBI. According to reports, the results show that it “circumvents computer owners’ Fourth Amendment rights.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Best Buy insists that they have a moral, and sometimes, legal, obligation to “report these findings to law enforcement,” as they are helping “discover and thwart illegal, abusive behavior,” reports Buzzfeed. However, the retailer assures consumers that they do not actively seek out illegal material and that employees have not received training from law enforcement to “learn how to find it,” reports Fortune.com
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Cars, College, and Community: October 19 at 11:11ame In highschool I wonder why they pushed college on us so hard instead of trades? They didn't tell me union plumbers can make $1,600 a week with no OT and NO DEGREE....or that truck drivers can make 6 bands a week if they buy their own truck w/NO DEGREE? OR that traveling welders can make 100k a year with NO DEGREE.they made it seem like college was the only way to be successful Like Comment Share nd 352 others 495 Shares I'm a weld Inspector, traveling inspectors can make 6 figures easy Oct 19 at 11:14am Love 2 Reply Delete plied- 3 replies That's awesome bro I'm a truck driver and we can make 6 figures as well with the right company. I just wonder why they ain't tell me about this shit in highschool. They made it seem like college was the only way Oct 19 at 11:16am Edited Like 3 Reply More <p><a href="https://triggeredmedia.tumblr.com/post/169276755942/dedicating-ruckus-rtrixie-triggeredmedia" class="tumblr_blog">triggeredmedia</a>:</p> <blockquote><p><a href="https://dedicating-ruckus.tumblr.com/post/169276064463/rtrixie-triggeredmedia-its-almost-as-if" class="tumblr_blog">dedicating-ruckus</a>:</p><blockquote> <p><a href="http://rtrixie.tumblr.com/post/169275885979/triggeredmedia-its-almost-as-if-schools-push" class="tumblr_blog">rtrixie</a>:</p> <blockquote> <p><a href="https://triggeredmedia.tumblr.com/post/169270049767/its-almost-as-if-schools-push-and-ideology-that" class="tumblr_blog">triggeredmedia</a>:</p> <blockquote><p>It’s almost as if schools push and ideology that benefits schools. </p></blockquote> <p>Trades are a valid option and there’s absolutely no shame in admitting that you can’t afford college. </p> </blockquote> <p style="">The modern push of College For All has only really served to bankrupt a lot of people who didn’t need it, and water down the degree for those who did.<br/></p> </blockquote><p>I honestly believe that’s part of the agenda of the left. Their entire platform is around the government taking care of you. </p><p>“You should do what you want. If that’s feminist dance study so be it. Oh you can’t take care of your family now? Proof we need more government. ”</p><p>There are over 6 million open jobs right now in this country. Two-thirds of jobs in this country don’t require any sort of degree. </p><p>This is where left is usually respond with “but automation” as proof that there’s not going to be any jobs. </p><p>That’s exactly what they said when cars and were invented in horse carriage and farming was changed.</p><p>That’s what they said when computers replace most office workers.</p><p>We have more jobs now with more technology and more automation. They’re just different jobs. </p></blockquote> <p>They obviously pushed it to funnel more money into the money pit that is student loans. I need a degree for the things I want to do, but I wish I had gone about it a different way. Right now my sister is taking part high school classes and part cosmetology classes at a community college. By the time she goes to a “real college” she should be able to go as a junior and save tons of money. Kids if you’re still in high school listen to me: don’t let anybody tell you you absolutely have to go to a four-year school you can’t afford just to be successful. Don’t let anybody talk you into taking out $50,000+ in loans that you’ll never be able to pay back. Consider your options, look at community college offerings and dual enrollment and online credits. We have more ways than ever to get a well-rounded education and qualifications for the things we need to do.</p>