yours
yours

yours

comming
comming

comming

leaving
leaving

leaving

gagging
gagging

gagging

gagged
gagged

gagged

gag
gag

gag

computing
computing

computing

they
they

they

com
com

com

🤖
🤖

🤖

🔥 | Latest

Best Buy, Computers, and Doctor: FBl Has Been Working with Best Buy's Geek Squad to Crack Down on Child Porn Found on People's Computers @balleralert EST BUY FBI Has Been Working with Best Buy’s Geek Squad to Crack Down on Child Porn Found on People's Computers-blogged by @thereal__bee ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ According to reports, the FBI has been working with Best Buy’s Geek Squad computer repairmen for almost a decade. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ The FBI reportedly paid the employees to flag and disclose illegal content that they found on people’s computers, specifically in reference to child pornography. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ According to the Electronic Frontier Foundation’s account, if a Geek Squad employee finds potentially illegal content on a computer during inspection, they are to contact the FBI and notify them. The agents then review the content, if it is illegal, they then seize the device. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ In at least one incident, the FBI reportedly paid a Geek Squad employee $500 for reporting illegal content. They then proceeded to use him as an informant. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ After the prosecution of a California doctor for child abuse imagery found on his computer, the EFF filed a Freedom of Information request to get more knowledge about the extent of the relationship between Geel Squad employers and the FBI. According to reports, the results show that it “circumvents computer owners’ Fourth Amendment rights.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Best Buy insists that they have a moral, and sometimes, legal, obligation to “report these findings to law enforcement,” as they are helping “discover and thwart illegal, abusive behavior,” reports Buzzfeed. However, the retailer assures consumers that they do not actively seek out illegal material and that employees have not received training from law enforcement to “learn how to find it,” reports Fortune.com
Best Buy, Computers, and Doctor: FBl Has Been Working with Best
 Buy's Geek Squad to Crack Down on
 Child Porn Found on People's
 Computers
 @balleralert
 EST
 BUY
FBI Has Been Working with Best Buy’s Geek Squad to Crack Down on Child Porn Found on People's Computers-blogged by @thereal__bee ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ According to reports, the FBI has been working with Best Buy’s Geek Squad computer repairmen for almost a decade. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ The FBI reportedly paid the employees to flag and disclose illegal content that they found on people’s computers, specifically in reference to child pornography. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ According to the Electronic Frontier Foundation’s account, if a Geek Squad employee finds potentially illegal content on a computer during inspection, they are to contact the FBI and notify them. The agents then review the content, if it is illegal, they then seize the device. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ In at least one incident, the FBI reportedly paid a Geek Squad employee $500 for reporting illegal content. They then proceeded to use him as an informant. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ After the prosecution of a California doctor for child abuse imagery found on his computer, the EFF filed a Freedom of Information request to get more knowledge about the extent of the relationship between Geel Squad employers and the FBI. According to reports, the results show that it “circumvents computer owners’ Fourth Amendment rights.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀ Best Buy insists that they have a moral, and sometimes, legal, obligation to “report these findings to law enforcement,” as they are helping “discover and thwart illegal, abusive behavior,” reports Buzzfeed. However, the retailer assures consumers that they do not actively seek out illegal material and that employees have not received training from law enforcement to “learn how to find it,” reports Fortune.com

FBI Has Been Working with Best Buy’s Geek Squad to Crack Down on Child Porn Found on People's Computers-blogged by @thereal__bee ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

America, Computers, and Dell: KT IT'S MINED ILLEGALLY THERE. There is a war in the Congo for coltan, over 7 million people have died in the last 10 years as a result of this war. 45,000 a month die. Why is poverty legal, why doesn't America or the UK jump in to the Congo and save the day? Because they make money from it. The United Nations notes in its 2001 report on the Illegal Exploitation of Natural Resources in the Congo that "The consequences of illegal exploitation has been twofold: (a)massive availability of financial resources for the Rwandan Patriotic Army, and the individual enrichment of top Ugandan military commanders and civilians; (b) the emergence of of illegal networks headed by either top military officers or businessmen." Foreign multi-national corporations have been deeply involved in the exploitation of coltan in the Congo. The coltan mined by rebels and foreign forces is sold to foreign corporations. Although, the United Nations in its reports on the Congo do not directly blame the multi-national corporations for the conflict in the Congo, the United Nations does say that these companies serve as "the engine of the conflict in the DRC." Major United States players include: Cabot Corporation, Boston, MA OM Group, Cleveland, Ohio AVX, Myrtle Beach, SC Eagle Wings Resources International, Ohio Trinitech International, Ohio Kemet Electronics Corporation, Greenville, SC Once the coltan is processed and converted to capacitors, it is then sold to companies such as Nokia, Motorola, Compaq, Alcahnntel, Dell, Hewlett-Packard , IBM, Lucent, Ericsson and Sony for use in a wide assortment of everyday products ranging from cell phones to computer chips and game consoles. What are some of the uses of coltan in modern society? • Laptop computers • Cellular phones • Jet engines th • Rockets • Cutting tools • Camera lensesbby • X-ray film • Ink jet printers • Hearing aids • Pacemakers • Airbag protection systems • Ignition and motor control modules, GPS, ABS systems in automobiles • Game consoles such as playstation, xbox and nintendo • Video cameras • Digital still cameras • Sputtering targets • Chemical process equipment more below chakabars @problkthought
America, Computers, and Dell: KT
 IT'S MINED
 ILLEGALLY THERE.
There is a war in the Congo for coltan, over 7 million people have died in the last 10 years as a result of this war. 45,000 a month die. Why is poverty legal, why doesn't America or the UK jump in to the Congo and save the day? Because they make money from it. The United Nations notes in its 2001 report on the Illegal Exploitation of Natural Resources in the Congo that "The consequences of illegal exploitation has been twofold: (a)massive availability of financial resources for the Rwandan Patriotic Army, and the individual enrichment of top Ugandan military commanders and civilians; (b) the emergence of of illegal networks headed by either top military officers or businessmen." Foreign multi-national corporations have been deeply involved in the exploitation of coltan in the Congo. The coltan mined by rebels and foreign forces is sold to foreign corporations. Although, the United Nations in its reports on the Congo do not directly blame the multi-national corporations for the conflict in the Congo, the United Nations does say that these companies serve as "the engine of the conflict in the DRC." Major United States players include: Cabot Corporation, Boston, MA OM Group, Cleveland, Ohio AVX, Myrtle Beach, SC Eagle Wings Resources International, Ohio Trinitech International, Ohio Kemet Electronics Corporation, Greenville, SC Once the coltan is processed and converted to capacitors, it is then sold to companies such as Nokia, Motorola, Compaq, Alcahnntel, Dell, Hewlett-Packard , IBM, Lucent, Ericsson and Sony for use in a wide assortment of everyday products ranging from cell phones to computer chips and game consoles. What are some of the uses of coltan in modern society? • Laptop computers • Cellular phones • Jet engines th • Rockets • Cutting tools • Camera lensesbby • X-ray film • Ink jet printers • Hearing aids • Pacemakers • Airbag protection systems • Ignition and motor control modules, GPS, ABS systems in automobiles • Game consoles such as playstation, xbox and nintendo • Video cameras • Digital still cameras • Sputtering targets • Chemical process equipment more below chakabars @problkthought

There is a war in the Congo for coltan, over 7 million people have died in the last 10 years as a result of this war. 45,000 a month die. Wh...

Computers, Life, and Memes: 2 OR SHOULDER STRETCH 3 Chest Open @DeskboundTherapy HOW TO FIX TIGHT SHOULDERS · It's been a while since I've talked about Surving The Desk Life (btw, do y'all want more of those? LMK below 👇) so here's a super simple stretch you can do by none other than @deskboundtherapy. · Most adults have very limited shoulder extension range of motion. Tight muscles like the biceps and pecs play a role in keeping the shoulders chronically flexed and depressed, making this extended position behind the body inaccessible. And all the time hunched over our computers and phones don't help the situation.💻😩 · Try this shoulder stretch from your chair and notice a deep stretch across the front of the shoulder and possibly into the bicep. This is a great way to ensure you spend some quality time hanging in shoulder extension as opposed to a flexed shoulder position with ours arms reaching in front of our body. · You can make this stretch less intense by adjusting the height of your hand position on the chair or by using stretching one shoulder at a time vs both. Play around with the pose and see how you body best likes to be positioned 🔑 · Tips to Perform Correctly 💯 1️⃣ Come to a seated position on the edge of your chair. 2️⃣Grip the chair behind you while maintaining a neutral spine position. 3️⃣Lift your chest up as you take a deep exhale. 4️⃣Hold this stretch for 30-40 seconds multiple times throughout the day, anytime you take a break from working. · If you want a vid, let me know. It might be time for a new installment of Surviving The Desk Life.🎥 MyodetoxOrlando DeskboundTherapy Myodetox
Computers, Life, and Memes: 2
 OR
 SHOULDER STRETCH
 3
 Chest Open
 @DeskboundTherapy
HOW TO FIX TIGHT SHOULDERS · It's been a while since I've talked about Surving The Desk Life (btw, do y'all want more of those? LMK below 👇) so here's a super simple stretch you can do by none other than @deskboundtherapy. · Most adults have very limited shoulder extension range of motion. Tight muscles like the biceps and pecs play a role in keeping the shoulders chronically flexed and depressed, making this extended position behind the body inaccessible. And all the time hunched over our computers and phones don't help the situation.💻😩 · Try this shoulder stretch from your chair and notice a deep stretch across the front of the shoulder and possibly into the bicep. This is a great way to ensure you spend some quality time hanging in shoulder extension as opposed to a flexed shoulder position with ours arms reaching in front of our body. · You can make this stretch less intense by adjusting the height of your hand position on the chair or by using stretching one shoulder at a time vs both. Play around with the pose and see how you body best likes to be positioned 🔑 · Tips to Perform Correctly 💯 1️⃣ Come to a seated position on the edge of your chair. 2️⃣Grip the chair behind you while maintaining a neutral spine position. 3️⃣Lift your chest up as you take a deep exhale. 4️⃣Hold this stretch for 30-40 seconds multiple times throughout the day, anytime you take a break from working. · If you want a vid, let me know. It might be time for a new installment of Surviving The Desk Life.🎥 MyodetoxOrlando DeskboundTherapy Myodetox

HOW TO FIX TIGHT SHOULDERS · It's been a while since I've talked about Surving The Desk Life (btw, do y'all want more of those? LMK below 👇)...