Thats
Thats

Thats

Spreaded
Spreaded

Spreaded

Fucking Amazing
Fucking Amazing

Fucking Amazing

Creepy Neighbor
Creepy Neighbor

Creepy Neighbor

Joshing
Joshing

Joshing

out-of-hand
out-of-hand

out-of-hand

neighbor
 neighbor

neighbor

no
 no

no

stable
stable

stable

yall
yall

yall

🔥 | Latest

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Apparently, Bless Up, and Boobies: MORE PEANUT BUTTER! Shout to u pretty older ladies that keep the bra on when we smash bc u self conscious and afraid the young buck that u with gonna be judgy about them girls being stretch marky and hangy when that bra pop off y’all cute. Bashful. Y’all adorable. BUT LISTEN HERE COT DAMMIT IF U DONT LET THEM GIRLS COME OUT AND PLAY WE GON HAVE ISSUES I NEED THE LIGHTS ON SHINING ON EVERY MINOR DETAIL AND ‘IMPERFECTION’ (personally I call them ‘perfections’. Butt dimples? Cellulite? Stretch marks? U perfect to me, aint a cot damn thing ‘im’ about it 🤗). U 42 NOT 22 YA BOOBIES NOT SUPPOSE TO BE UPRIGHT AND FIRM STARING OFF IN SEPARATE DIRECTIONS LIKE FETTY WAP’S EYES THEY SUPPOSE TO FLOP DOWN A LIL BIT AND THAT’S PART OF THE BEAUTY OF THINE SHAPE WHY U EMBARRASSED OF SOMETHING CUTE IN THE FIRST PLACE! THAT’S WHY I DON’T BE WEARING PANTS OR BOXERS I WALK AROUND NEKKY BECAUSE I’M CUTE, BIH! MY PP HANDSOME! FVCK U THOUGHT! EVEN WHEN THE ROOM 67.5 DEGREES AND MR. PEEPATOUS (he Greek apparently - to my knowledge I aint Greek but he Greek lmao “OPA!!!”) HATH PARTLY RECEDED INTO MY BODY FOR WARMTH AND COMFORT AW HELL NAH! HE STILL HANDSOME! LET THEM GIRLS OUT, WOMAN! SENDING SELFIES ON THE BED LAYING FLAT ARMS UP APPLYING EIGHT FILTERS CONTORTING YA ENTIRE COT DAMN EXISTENCE TO GET THEM GIRLS LOOKING YOUNG AND PERKY I AINT ASK FOR THAT! LEMME SEE *YOU* COT DAMMIT! LIKE CREEPY HOMEBOY MR HOT SPOT BE SAYING: “YEAH! I *LIKE* **THAT**!!” YA GET ME! BLESS UP 😍❤️😂😂😂 (Pic: Reddit u-tfro9)

Shout to u pretty older ladies that keep the bra on when we smash bc u self conscious and afraid the young buck that u with gonna be judgy a...

Creepy, Definitely, and Desperate: RATE THIS CHAT Today, 3:10 PM Neckbeardy?? What does women's issues have to do with the fact that if ur not hot u get called a creep for wanting to hang out Today, 3:58 PM it depends how you go about asking. i know literally no one who has beern called a creep for asking someone to hang out while looking average. if women are calling you a creep every time you ask them to hang... the problem isn't with women, it's with you. evaluate how you approach women. So my problem is that i shouldnt text hey whats up?" Or "hey we should So my problem is that i shouldnt text, hey whats up?" Or "hey we should hang out sometime" because its creepy??? But a friend of mine just sends a dick pic or whips it out and gets the girl and thats not creepy?? Must be the font style im using right? the thing is... yeah, some women are willing to hook up over a dick pic. women aren't all the same. lumping the whole group into "women think average guys are creeps but bang hot guys easily" is wildly inaccurate of most women. they're not some hivemind, they're individual people. sure, you can say "hey we should hang", but if you act pushy/desperate, make sexual comments, ignore boundaries, STEREOTYPE ALL WOMEN, etc they're gonna think you're a creep. like i said, step back and evaluate your behavior. make sure you're not doing anything that makes women uncomfortable. Like texting them lol ur not very smart dude i know you meant texting. all of the things i mentioned can be done over text. if you think they can't, then it's not me who's stupid... based on this conversation so far, yeah, i can definitely see why women don't want to hang out with you. you refuse to see them as anything more than a stereotype, you insult people who try to give you constructive feedback, you don't listen, and you seem to only think about yourself. Ur right bro. I should use different tone and inflections via text messages... especially when saying whats up... its gotta be selfish to ask what a girl is doing or how shes feeling feeling. I should just send a dick pic lol yeah, you're completely not getting it. well, i tried. there's no point in talking to a brick wall, so see ya. Whats there to get? I should change the way i say whats up?? like talking to a brick wall (OP from my last post messaged me)

like talking to a brick wall (OP from my last post messaged me)

Chill, College, and Creepy: u/a_slinky ld imgur This is Iggy. He is everything that is good in this world @DrSmashlove LET’S KEEP IT 600 HAVE YALL EVER MET SOMEONE NAMED STEPHANIE AT A WORK FUNCTION AND THEN U GOOGLE STEPHANIE AND U ELEVENTEEN PAGES DEEP ON STEPHANIE’s GOOGLE RESULTS AND U GET TO STEPHANIE’s WEBSITE ON “theknot” AND U JUST LIKE “wow they posed in front of the Bucks stadium wearing matching Bucks jerseys LMAO” AND U LOOKING THRU THE GROOMSMEN FOR ROGER, THE GROOM, AND U SCROLLING THRU “Todd: Frat Brother”, “Jeff: The Troublemaker (Editor’s Note: Jeff is always overweight with a baby face and is wearing a bow tie lmao)”, and u get to “Kelly, the Groomswoman” AND U JUST LIKE “wow I wonder if Stephanie low key hates Kelly and wonders if once, just once, Kelly got extra drunky at college at smashed Roger but they never smashed again but Roger still low key loves her and thinks about her lol wow that’s wild Kelly u wild, started at a bar crawl now u here LMAO LMAO” SO U GOOGLE “Kelly Patterson” AND FIND OUT THAT SHE ACTUALLY HAS A BOYFRIEND NAMED RICK AND U WONDER IF THE BOYFRIEND IS A LITTLE TIGHT THAT MAYBE KELLY SMASHED ROGER TOO AND THEN IT DAWNS ON U. IT DAWNS ON U, BRUV. RIGHT THEN AND THERE. U HAVE GOOGLE STALKED THIS WEB OF FRIENDS INTO THE Nth MOTHERFVCKING DIMENSION BRUV. IT’S NOWHERE TO TAKE IT NOW. WHAT’S THE LIMIT? HAS SCIENCE GONE TOO FAR? AND THEN U FEEL LOW KEY SAD AND IT DAWNS ON U THAT U NEED TO GET RIGHT WITH GOD BUT U DECIDE TO SEE WHO KELLY IS FOLLOWING AND LOW AND BEHOLD SHE FOLLOWS SMASH (and u wondering: do she follow for the pups? The captions? Both? 😜) SO REALLY U AIN’T STALKING AT ALL U JUST GAZING DOWN AT YO FOLLOWERS FROM UP HIGH ON YO LONELY INSTAGRAM PERCH AND NOW INSTEAD OF FEELING CREEPY U CONSIDERING DM’ing HER LIKE “aye so did u smash Roger? 😏Lmao 🤓” BUT THEN U REMIND YOURSELF TO CHILL HAPPY FRIDAY 🤗😂😂😂

LET’S KEEP IT 600 HAVE YALL EVER MET SOMEONE NAMED STEPHANIE AT A WORK FUNCTION AND THEN U GOOGLE STEPHANIE AND U ELEVENTEEN PAGES DEEP ON S...