dna


                    
                    
                
Testes
Testes

Testes

I Dont Want To
I Dont Want To

I Dont Want To

Mentiones
Mentiones

Mentiones

came back
 came back

came back

woke
woke

woke

yours
yours

yours

ons
ons

ons

courtesy
courtesy

courtesy

comming
comming

comming

on the fly
on the fly

on the fly

🔥 | Latest

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Memes, News, and Pregnant: Surrogate Gives Birth to Two Babies, Later Finds Out One ls Her Biological Child @balleralert Surrogate Gives Birth to Two Babies, Later Finds Out One Is Her Biological Child – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ A California woman gave birth to “twins,” after she became pregnant with her own child while carrying another baby as a surrogate. Jessica Allen surprisingly became pregnant because of a medical condition called superfetation, when a woman ovulates during pregnancy, PEOPLE reports. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “I didn’t even know I was pregnant with [him],” Allen said, adding that doctors initially thought the babies were twins. “I carried my own child and I didn’t know he was mine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to reports, the babies were delivered last December and went home with the Chinese couple, who were expecting one baby. But, when she saw a photo of the boys a few months later, she realized something different about one of the baby boys. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As time passed, Allen found out that she was the biological mother of one of the babies. A DNA test later confirmed the news. After an “emotional” legal battle between her and the Chinese couple, Allen and her husband were granted custody of their son in February. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “I don’t regret becoming a surrogate mom because that would mean regretting my son,” Allen said. “I just hope other women considering surrogacy can learn from my story.”
Memes, News, and Pregnant: Surrogate Gives Birth to Two Babies,
 Later Finds Out One ls Her Biological
 Child
 @balleralert
Surrogate Gives Birth to Two Babies, Later Finds Out One Is Her Biological Child – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ A California woman gave birth to “twins,” after she became pregnant with her own child while carrying another baby as a surrogate. Jessica Allen surprisingly became pregnant because of a medical condition called superfetation, when a woman ovulates during pregnancy, PEOPLE reports. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “I didn’t even know I was pregnant with [him],” Allen said, adding that doctors initially thought the babies were twins. “I carried my own child and I didn’t know he was mine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to reports, the babies were delivered last December and went home with the Chinese couple, who were expecting one baby. But, when she saw a photo of the boys a few months later, she realized something different about one of the baby boys. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As time passed, Allen found out that she was the biological mother of one of the babies. A DNA test later confirmed the news. After an “emotional” legal battle between her and the Chinese couple, Allen and her husband were granted custody of their son in February. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “I don’t regret becoming a surrogate mom because that would mean regretting my son,” Allen said. “I just hope other women considering surrogacy can learn from my story.”

Surrogate Gives Birth to Two Babies, Later Finds Out One Is Her Biological Child – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ A California woman g...

Aww, Bless Up, and Emoji: r/aww u/ButZebrasCantSmell 18h i.redd.it This little guy followed me home and then fell asleep on my lap, so l guess I have a dog now @DrSmashlove See bruv it’s two reactions u get from ladies when u laying pipe for the first time and bust a lil early. Type 1: she hear u moan and groan and let loose the juice and she just do this grin: 😌. Like “it’s ok baby I understand 😌 this Nani feels like silk soaked in honey and coated in mango juice 😌 I don’t expect u to last more than a few strokes 😌 it’s the price of having A1 Nani 😌.” Like that’s literally what this emoji was based off of - it’s the “it’s ok my adorable Minute Man 😌” emoji 😂. Now then, Type 2: she ain’t playing bruv. Type 2 came here for some proper pipe and yo early arrival mean u just deprived her of the value of her investment. She ain’t having it. U let out half a moan - not even a full moan and groan - just literally “AHP-“ and her eyes turn red. Her face morph into the face of a she-devil 👹. Horns emerge straight on her head top. And she always say the same thing: “NOT...YET!!!! 👿” and then she hit u with the Type 2 leg lock Bruv. She wrap her arms and legs around u like: “YOU MINUTE MAN LOOKIN A$$ I’M NOT GON LET U PULL OUT IMMA HAVE YO BABY TO TEACH U A LESSON ABOUT BUSTING EARLY U THOUGHT SH!T WAS SWEET WELL LEMME TELL U HOW SWEET: EVERY TIME U LOOK IN THE FACE OF THIS BABY U GON REMEMBER THE TIME U THOUGHT IT WAS OK TO BUST AFTER A FEW STROKES - HELL NAW - NOW GIMME THIS WORK AND LET ME NAME THIS BABY WITHOUT CONSULTING U. “Zeena”. ISSA GREEK NAME THAT MEANS “stranger, guest” WHICH IS APPROPRIATE BECAUSE IMMA HAVE FULL CUSTODY AND U GON SHOW UP WITH MY MONTHLY SUPPORT AS A GUEST IN A CRIB *YOU* PAYING FOR HOWBOWDAH 👿.” And u thinking “naw baby relax it’s all good round 2 gon be amazing 😬” and she just like “sorry I had other plans after this, expect to get served with a DNA test in 9 months bless up.” Type 2 ladies imma need y’all to learn from yo Type 1 sisters. Embrace the fact that your Nani A1. Give him another chance. U ain’t gotta go off and have his baby to teach him a lesson - let him cool his jets and give u the bidness one mo ‘gain. And if he bust early, cut him off forever. AND THEN DM ME IMMEEJALLY BECAUSE IT MEAN U GOT THAT UNICORN NANI AND WE SHOULD GET MARRIED AND HAVE CHIRREN BLESS UP 🤗😂😂😂
Aww, Bless Up, and Emoji: r/aww
 u/ButZebrasCantSmell 18h i.redd.it
 This little guy followed me home and
 then fell asleep on my lap, so l guess I
 have a dog now
 @DrSmashlove
See bruv it’s two reactions u get from ladies when u laying pipe for the first time and bust a lil early. Type 1: she hear u moan and groan and let loose the juice and she just do this grin: 😌. Like “it’s ok baby I understand 😌 this Nani feels like silk soaked in honey and coated in mango juice 😌 I don’t expect u to last more than a few strokes 😌 it’s the price of having A1 Nani 😌.” Like that’s literally what this emoji was based off of - it’s the “it’s ok my adorable Minute Man 😌” emoji 😂. Now then, Type 2: she ain’t playing bruv. Type 2 came here for some proper pipe and yo early arrival mean u just deprived her of the value of her investment. She ain’t having it. U let out half a moan - not even a full moan and groan - just literally “AHP-“ and her eyes turn red. Her face morph into the face of a she-devil 👹. Horns emerge straight on her head top. And she always say the same thing: “NOT...YET!!!! 👿” and then she hit u with the Type 2 leg lock Bruv. She wrap her arms and legs around u like: “YOU MINUTE MAN LOOKIN A$$ I’M NOT GON LET U PULL OUT IMMA HAVE YO BABY TO TEACH U A LESSON ABOUT BUSTING EARLY U THOUGHT SH!T WAS SWEET WELL LEMME TELL U HOW SWEET: EVERY TIME U LOOK IN THE FACE OF THIS BABY U GON REMEMBER THE TIME U THOUGHT IT WAS OK TO BUST AFTER A FEW STROKES - HELL NAW - NOW GIMME THIS WORK AND LET ME NAME THIS BABY WITHOUT CONSULTING U. “Zeena”. ISSA GREEK NAME THAT MEANS “stranger, guest” WHICH IS APPROPRIATE BECAUSE IMMA HAVE FULL CUSTODY AND U GON SHOW UP WITH MY MONTHLY SUPPORT AS A GUEST IN A CRIB *YOU* PAYING FOR HOWBOWDAH 👿.” And u thinking “naw baby relax it’s all good round 2 gon be amazing 😬” and she just like “sorry I had other plans after this, expect to get served with a DNA test in 9 months bless up.” Type 2 ladies imma need y’all to learn from yo Type 1 sisters. Embrace the fact that your Nani A1. Give him another chance. U ain’t gotta go off and have his baby to teach him a lesson - let him cool his jets and give u the bidness one mo ‘gain. And if he bust early, cut him off forever. AND THEN DM ME IMMEEJALLY BECAUSE IT MEAN U GOT THAT UNICORN NANI AND WE SHOULD GET MARRIED AND HAVE CHIRREN BLESS UP 🤗😂😂😂

See bruv it’s two reactions u get from ladies when u laying pipe for the first time and bust a lil early. Type 1: she hear u moan and groan ...