Trumped
Trumped

Trumped

Trumping
Trumping

Trumping

First Time
First Time

First Time

Trumps
Trumps

Trumps

Caught
Caught

Caught

That Hurt
That Hurt

That Hurt

Trump Face
Trump Face

Trump Face

That Hurts
That Hurts

That Hurts

Legging
Legging

Legging

Face You Make
Face You Make

Face You Make

🔥 | Latest

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Family, Food, and Friends: lt's Been Eight Years Since The Massive Earthquake in Haiti And Millions Are Still Suffering @balleralert hotoGrid It’s Been Eight Years Since The Massive Earthquake in Haiti And Millions Are Still Suffering - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On this day, eight years ago, a severe earthquake nearly destroyed Haiti. Almost 316,000 lives were taken and more than 1.5 million have had to relocate. According to a new report from the United Nations, there are currently 2.5 million Haitians who are still suffering from the aftermath. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ The 2010 Haiti earthquake was not just a simple natural disaster. Since then the people of Haiti have struggled with continuous famine and are forced to live in impoverishment. They’ve also been exposed to the sometimes fatal cholera epidemic. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ “Haitians continue to suffer years after the earthquake,” U.N. Humanitarian Coordinator Mourad Wahba, who has worked in the country for two years, told The WorldPost. “People lost their friends and family. I see the pain in their faces when they talk about it now. It’s a very long healing process.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ According to reports, over 300,000 Haitians were harmed back in 2010, and the earthquake left 3.3 million with a lack of food supply. More than 80 percent of public housing was destroyed, hundreds became homeless and were forced to live in “tent cities.” School and government buildings were ruined, as well as farmland, decimated crops and irrigation canals. Haiti was once known for its strong agriculture, for which the country relied on. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ “There are still about 55,000 people in camps and makeshift camps,” noted Wahba. “Many are still living in unsanitary conditions due to displacement caused by the earthquake. We have a very long way to go.”
Family, Food, and Friends: lt's Been Eight Years Since The
 Massive Earthquake in Haiti And
 Millions Are Still Suffering
 @balleralert
 hotoGrid
It’s Been Eight Years Since The Massive Earthquake in Haiti And Millions Are Still Suffering - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On this day, eight years ago, a severe earthquake nearly destroyed Haiti. Almost 316,000 lives were taken and more than 1.5 million have had to relocate. According to a new report from the United Nations, there are currently 2.5 million Haitians who are still suffering from the aftermath. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ The 2010 Haiti earthquake was not just a simple natural disaster. Since then the people of Haiti have struggled with continuous famine and are forced to live in impoverishment. They’ve also been exposed to the sometimes fatal cholera epidemic. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ “Haitians continue to suffer years after the earthquake,” U.N. Humanitarian Coordinator Mourad Wahba, who has worked in the country for two years, told The WorldPost. “People lost their friends and family. I see the pain in their faces when they talk about it now. It’s a very long healing process.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ According to reports, over 300,000 Haitians were harmed back in 2010, and the earthquake left 3.3 million with a lack of food supply. More than 80 percent of public housing was destroyed, hundreds became homeless and were forced to live in “tent cities.” School and government buildings were ruined, as well as farmland, decimated crops and irrigation canals. Haiti was once known for its strong agriculture, for which the country relied on. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ “There are still about 55,000 people in camps and makeshift camps,” noted Wahba. “Many are still living in unsanitary conditions due to displacement caused by the earthquake. We have a very long way to go.”

It’s Been Eight Years Since The Massive Earthquake in Haiti And Millions Are Still Suffering - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀...

Christmas, Drugs, and Jail: Cannabis Kringle: Elderly Couple Arrested With 60 Pounds Of Weed They Planned To Give Out As Christmas Gifts @balleralert SHERIFF 17015229, Cannabis Kringle: Elderly Couple Arrested With 60 Pounds Of Weed They Planned To Give Out As Christmas Gifts – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On Tuesday, an elderly couple was on their way to Boston and Vermont when York County, Nebraska officials stopped them in their tracks for failing to signal. During the stop, officials smelled marijuana and asked to search the vehicle. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Upon the search, 80-year-old Patrick Jiron agreed and admitted to having the illegal substance in his car. As officials conducted the authorized search, deputies found 60 pounds of weed in the pickup topper, with multiple containers of concentrated THC, all worth more than $300,000. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to reports, the couple was traveling from northern California, attempting to deliver the marijuana for Christmas presents. But now, the couple faces felony possession charges, as they had no drug tax stamp, which is required in Nebraska to deal drugs. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The two were arrested on Interstate 80 and cited on charges on possession of marijuana with the intent to deliver and of lacking a drug tax stamp. According to reports, while Jiron is being held in the York County jail, his 83-year-old wife has been cited but not locked up, “due to some medical issues.”
Christmas, Drugs, and Jail: Cannabis Kringle: Elderly Couple
 Arrested With 60 Pounds Of Weed They
 Planned To Give Out As Christmas Gifts
 @balleralert
 SHERIFF
 17015229,
Cannabis Kringle: Elderly Couple Arrested With 60 Pounds Of Weed They Planned To Give Out As Christmas Gifts – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On Tuesday, an elderly couple was on their way to Boston and Vermont when York County, Nebraska officials stopped them in their tracks for failing to signal. During the stop, officials smelled marijuana and asked to search the vehicle. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Upon the search, 80-year-old Patrick Jiron agreed and admitted to having the illegal substance in his car. As officials conducted the authorized search, deputies found 60 pounds of weed in the pickup topper, with multiple containers of concentrated THC, all worth more than $300,000. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to reports, the couple was traveling from northern California, attempting to deliver the marijuana for Christmas presents. But now, the couple faces felony possession charges, as they had no drug tax stamp, which is required in Nebraska to deal drugs. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The two were arrested on Interstate 80 and cited on charges on possession of marijuana with the intent to deliver and of lacking a drug tax stamp. According to reports, while Jiron is being held in the York County jail, his 83-year-old wife has been cited but not locked up, “due to some medical issues.”

Cannabis Kringle: Elderly Couple Arrested With 60 Pounds Of Weed They Planned To Give Out As Christmas Gifts – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ...

Arguing, Dating, and Life: Louisiana Man Faces Life In Prison For Killing Girlfriend's Convicted Molester, Says He's "Not Sorry" @balleralert Louisiana Man Faces Life In Prison For Killing Girlfriend’s Convicted Molester, Says He’s “Not Sorry” – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On Thursday, a Louisiana man was found guilty on charges of second-degree murder after he admitted to killing the man who molested his girlfriend. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to reports, the incident occurred in July 2015. Brittany Monk, the girlfriend, testified in court that she and her boyfriend, Jace Crehan, broke into the convicted molester’s trailer and tried to scare him. However, things took a turn for the worse after she sprayed cologne in Robert Noce Jr.’s face. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As she stood before the court, Monk said she told Noce, who was convicted of sexually assaulting Monk for nine years, that he ruined her life. She said her boyfriend then instructed her to get a knife, to which she complied, retrieving the “biggest” knife she could find. Crehan then used the knife to stab Noce repeatedly, just before wrapping a belt around Noce’s neck, using his foot to pull it tighter. After the struggle, the two threw Noce’s body in a 55-gallon container and threw the knife in a lake. Days later, Daily News reports, Crehan admitted to the murder, as he believed the justice system “failed” his girlfriend. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The incident occurred just days after Noce pleaded no contest to sexually molesting Monk while he was dating her mother. However, Crehan said he was “not sorry” for his actions, in fact, he revealed that he felt “a lot better.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Although Crehan’s attorney attempted to argue that his actions were in passion, prosecutors said they were “vigilante” justice, adding that, “We do not live in a country where we as a society are allowed to take the law into our own hands and do justice.” As a result, a jury found Crehan guilty of second-degree murder, he is now facing life in prison. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Monk, on the other hand, pleaded guilty to manslaughter earlier this year and is facing 40 years in prison.
Arguing, Dating, and Life: Louisiana Man Faces Life In Prison For
 Killing Girlfriend's Convicted Molester, Says
 He's "Not Sorry"
 @balleralert
Louisiana Man Faces Life In Prison For Killing Girlfriend’s Convicted Molester, Says He’s “Not Sorry” – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On Thursday, a Louisiana man was found guilty on charges of second-degree murder after he admitted to killing the man who molested his girlfriend. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ According to reports, the incident occurred in July 2015. Brittany Monk, the girlfriend, testified in court that she and her boyfriend, Jace Crehan, broke into the convicted molester’s trailer and tried to scare him. However, things took a turn for the worse after she sprayed cologne in Robert Noce Jr.’s face. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As she stood before the court, Monk said she told Noce, who was convicted of sexually assaulting Monk for nine years, that he ruined her life. She said her boyfriend then instructed her to get a knife, to which she complied, retrieving the “biggest” knife she could find. Crehan then used the knife to stab Noce repeatedly, just before wrapping a belt around Noce’s neck, using his foot to pull it tighter. After the struggle, the two threw Noce’s body in a 55-gallon container and threw the knife in a lake. Days later, Daily News reports, Crehan admitted to the murder, as he believed the justice system “failed” his girlfriend. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The incident occurred just days after Noce pleaded no contest to sexually molesting Monk while he was dating her mother. However, Crehan said he was “not sorry” for his actions, in fact, he revealed that he felt “a lot better.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Although Crehan’s attorney attempted to argue that his actions were in passion, prosecutors said they were “vigilante” justice, adding that, “We do not live in a country where we as a society are allowed to take the law into our own hands and do justice.” As a result, a jury found Crehan guilty of second-degree murder, he is now facing life in prison. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Monk, on the other hand, pleaded guilty to manslaughter earlier this year and is facing 40 years in prison.

Louisiana Man Faces Life In Prison For Killing Girlfriend’s Convicted Molester, Says He’s “Not Sorry” – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀...