Trumped
Trumped

Trumped

Trumping
Trumping

Trumping

First Time
First Time

First Time

Trumps
Trumps

Trumps

Caught
Caught

Caught

That Hurt
That Hurt

That Hurt

Trump Face
Trump Face

Trump Face

That Hurts
That Hurts

That Hurts

Legging
Legging

Legging

Face You Make
Face You Make

Face You Make

🔥 | Latest

4chan, America, and Anime: Researchers Studied 160 Milliorn Memes and Found Most of Them Come From Two Websites A study of hundreds of millions of images from Reddit, 4chan, Gab, and Twitter reveals how memes spread. Samantha Cole Jun 12 2018,10:27am 产ブ Researchers at University College London developed a new way to measure how memes are made and spread. What they found won't surprise anyone who's peered into the darker parts of the internet in the last few years: The most toxic, yet most effectively spread, memes are first shared on two places, the subreddit r/the_donald and 4chan's "politically incorrect" forum, called /pol/ Smug Frog Meme Image Cluster 1 Cluster N Figure 1: An example of a meme (Smug Frog) that provides an intu- ition of what an image, a cluster, and a meme is. When? Where? What? Who? How apustaja sad-frog savepepe pepe smug-frog-asmug-frog-b anti-meme 0.6 o 0.4 0.2 0.0 Figure 6: Inter-cluster distance between all clusters with frog memes. Clusters are labeled with the origin (4 for 4chan, D for The Donald, and G for Gab) and the meme name. To ease readability, we do not display all labels, abbreviate meme names, and only show an excerpt of all relationships. Smug Anime Face He will not divide us Costanza DemotivationalPosters Smug Polandball Anime Forty Keks Absolutely Disgusting Face Doom Paul Its Happening POTENTIAI forty keks IT DIDN'T MAVE TO END LIKE ABSOLUTELY DISGUSTIN REAT AGAIN Make America Colbertposting Great Again . Smug Frog Dubs/Check'em Computer Reaction Faces Apu Apustaja Reaction Images Wojak/ Feels Guy This is bait. 60's Spiderman Bait this is Bait Into the Trash it goes Sad Frog smug eastern Happy Merchant Counter Signa Memes IKNOW THAT FEEL BRO Baneposting autistic screeching Pepe the Frog I Know that Feel Bro WHY Tony Kornheiser's Why Feels Good Laughing Tom Donald Trump's Murica Angry Pepe Cruise Well Autistic Screeching Spurdo Sparde Figure 7: Visualization of the obtained clusters from /pol/, The Donald, and Gab Well would you look at that... Since the left can't meme we get labeled as hateful.

Well would you look at that... Since the left can't meme we get labeled as hateful.

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Family, Food, and Friends: lt's Been Eight Years Since The Massive Earthquake in Haiti And Millions Are Still Suffering @balleralert hotoGrid It’s Been Eight Years Since The Massive Earthquake in Haiti And Millions Are Still Suffering - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On this day, eight years ago, a severe earthquake nearly destroyed Haiti. Almost 316,000 lives were taken and more than 1.5 million have had to relocate. According to a new report from the United Nations, there are currently 2.5 million Haitians who are still suffering from the aftermath. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ The 2010 Haiti earthquake was not just a simple natural disaster. Since then the people of Haiti have struggled with continuous famine and are forced to live in impoverishment. They’ve also been exposed to the sometimes fatal cholera epidemic. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ “Haitians continue to suffer years after the earthquake,” U.N. Humanitarian Coordinator Mourad Wahba, who has worked in the country for two years, told The WorldPost. “People lost their friends and family. I see the pain in their faces when they talk about it now. It’s a very long healing process.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ According to reports, over 300,000 Haitians were harmed back in 2010, and the earthquake left 3.3 million with a lack of food supply. More than 80 percent of public housing was destroyed, hundreds became homeless and were forced to live in “tent cities.” School and government buildings were ruined, as well as farmland, decimated crops and irrigation canals. Haiti was once known for its strong agriculture, for which the country relied on. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ “There are still about 55,000 people in camps and makeshift camps,” noted Wahba. “Many are still living in unsanitary conditions due to displacement caused by the earthquake. We have a very long way to go.”

It’s Been Eight Years Since The Massive Earthquake in Haiti And Millions Are Still Suffering - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀...