◀
Share
Related
🔥 | Latest
Anna, Funny, and Google: This is Anna Diop. She is going
to play Starfire in the
upcoming TV show "Titans"
This is how she's gonna look like
This is what we could have gotten
(random picture I found on google)
I say don't blame the actress,
blame the director
This is gonna be a monstrosity...
This is gonna be a monstrosity...
Bae, Crazy, and Lol: Yasssss Daddy! Good Peen Will Make
A Woman Do Some Crazy Sh*t
@balleralert
Yasssss Daddy! Good Peen Will Make A Woman Do Some Crazy Sh*t- blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Ladies, I know I’m not the only one that has gotten some peen and did some of the craziest sh*ts ever. Like every time you and bae have a rendezvous, he hits every spot just right. “When He F*ck Me Good, I Take His A$$ To Red Lobster” type of sex. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Bae’s sex is so amazing that every time he leaves home, you calling like, “Where you at?” “You coming home soon?” Hell, you don’t want the next chick getting what you receive at home. You want to make sure he brings that a$$ home every night. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Great sex will have you trying to have his baby. You get so wrapped up in the sex night after night and find yourself screaming, “I want to have your baby!” Most of the time it comes out because you don’t him to stop and you feel him pulsate inside of you. (Don’t try and front in the comments like you haven’t done it. If not, he’s coming so watch out lol). ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Good peen will have you singing all kinds of love songs. You get so wrapped up that you can’t believe the things you are doing. His peen got you feeling like a straight sap lol. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ A good man with good peen is often hard to come by. But when he does come around, you better hold on and bring the freak out every chance you get. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ What’s the craziest thing you have ever done after getting some good peen?
Yasssss Daddy! Good Peen Will Make A Woman Do Some Crazy Sh*t- blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Ladies, I know I’m not the only one tha...
Family, Friends, and Memes: what has
how i met your mother
meant to you?
女,1
How I Met Your Mother
quickly become a family.
We're like a family now
It feels in a way more like family
than it does like friends.
I've gotten a wonderful
extended family
Ugh 😍😭 #HIMYM https://t.co/EpMFS9x7g8
Ugh 😍😭 #HIMYM https://t.co/EpMFS9x7g8
Memes, Music, and Lost: When you get lost in her eyes..
TAG A FRIEND 😂 ‼️ So I was on the train and seen this baddie @zashias320 looking at me.. I could have sworn she wanted this oooooouuuu nah nah but I got so lost in the music she left me with @classicnigerian 😩😩.. should I have gotten off the train??? ➖➖➖➖➖➖➖➖➖ Video by: @youngezee ft @zashias320 Song by: @all_hail_lloyd Miami
TAG A FRIEND 😂 ‼️ So I was on the train and seen this baddie @zashias320 looking at me.. I could have sworn she wanted this oooooouuuu nah n...
Energy, Fuck You, and Fucking: O 63%
08:42
charmcitywire.com
I'm All In On This Guy
Selling Energy Drinks
Filled With Crystal
Meth And Gasoline
Out Of His Tree Fort
Humor, News_May 6, 2015 at 2:24 pm by Zach
ENERO
DRINK
NERGY
Boone County Sheriff's Office
72-year-old Jasper June, of Boone County, West
Virginia was arrested on charges of making and
selling his homemade energy drinks containing
meth out of his tree fort. (A fucking tree fort, how
great is this guy)? When police showed up, they
found June wearing an adult diaper and browsing
through an Arabic porno magazine. Police tested 25
00 AT&T
08:43
o 63%!
charmcitywire.com
bottles of his energy drink, each of which contained
meth.
Police discovered June's practice after several high
school girls had to be hospitalized for internal
bleeding after consuming the drinks.
This is what June had to say about the drinks:
They're just energy drinks like Rockstar or
Monster. It's not meth in there. It's just lemonade,
caffeine, sugar and a couple drops of gasoline. I
swear to God I didn't put meth in there."
He then back tracked and went with this version:
"Okay,Iput just a little meth in there to get them
addicted and keep customers coming back. I know
they'll all testify against me so let me make
something else clear: I pissed in every bottle."
Well if there's one thing we know, it's that these
energy drinks are gonna work. Nothing will get you
jacked up like a little meth, gasoline, and human
urine. Bottom line is when you buy a product, you
08:43
O 63%
charmcitywire.com
want it to work. And if these little high school bitches
want to run and be narks after purchasing a quality
working energy drink for the bargain price of only 20
bucks, then I have no words. Plus, if you're them,
and you see this guy, selling this drink, and you still
buy it, that's on you.
I just love everything about Jasper June and his
retail business. He read pornos in a foreign
language while wearing his diaper, and when police
ask about his product, he is adamant that there Is
no meth in there, only gasoline. And then whern
forced to confess, he throws a big fuck you in there
and tells everyone these girls drank his piss too
lcing on the cake.
PS- How perfect is this guy's name and where he's
from? Jasper June from Boone County, West
Virginia selling meth out of his tree fort
Follow @zachhagerman
Via
Share:
Tweet
Like
551
Author: Zach
Tree Fort Piss and Meth Energy Drinks for 20.00. Takers?
Tree Fort Piss and Meth Energy Drinks for 20.00. Takers?
Bill Clinton, Hillary Clinton, and Memes: ASSOCLATED PRESS
Hillary herself
had gotten
Russia cash
when she was
Secretary of State
through her
husband;
hat wasn't
investigated by
the FBl either.
Interesting."
Tom Fittorn
President of
Judicial Watch
FOX
NEWS
On "America's News Headquarters," Judicial Watch President Tom Fitton accused Hillary Clinton, President Bill Clinton, and the Clinton Foundation of various Russia-related activities.
On "America's News Headquarters," Judicial Watch President Tom Fitton accused Hillary Clinton, President Bill Clinton, and the Clinton Found...
Fbi, Obama, and Iran: Donald J. Trump
@realDonaldTrum
Never gotten over the fact that Obama
was able to send $1.7 Billion Dollars in
CASH to Iran and nobody in Congress,
the FBI or Justice called for an
investigation!
4:02 AM Feb 18, 2018
Move along folks, nothing to see here
Move along folks, nothing to see here
Memes, Money, and Police: Grandmother Finds Grandson's
Plans For School Shooting a Day
Before Parkland Massacre
@balleralert
Grandmother Finds Grandson’s Plans For School Shooting a Day Before Parkland Massacre - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Another student was plotting a mass shooting at a Washington state high school but didn’t get away with it because his grandmother turned his plans into police. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On Tuesday, just a day before the Parkland, Fla. high school terror attack, Catherine Katsel-O’Connor called the police after she found notes in her grandson’s journal about shooting students at ACES high school. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ The grandmother says she was alarmed by the evil ideas her grandson Joshua Alexander O’Connor’s kept in his journal. But what shocked her more was the semi-automatic rifle she found in his guitar case. "I'm preparing myself for the school shooting,” the teenager wrote, according to court documents. “I can’t wait. My aim has gotten much more accurate ... I can’t wait to walk into that class and blow all those f--ers away." ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ As soon as authorities found out about the man’s plans they pulled him from his Kamiak High School class and arrested him. While in custody Joshua attempted to run away and kicked one of the police. In the end, police were able to subdue the man. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Joshua has been charged with attempted murder, assault of a police officer and armed robbery because of money he had stolen to fund his attack. His bail was set at $5 million.
Grandmother Finds Grandson’s Plans For School Shooting a Day Before Parkland Massacre - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Anot...
Community, Fake, and Memes: TECH
SNAPCHAT MELTDOWN
Feb 13 | Snapchat's recent update triggers
an overwhelmingly negative response
from users
Snapchat’s most recent software update has generated a negative response from users, many of whom vocalized their opinions through tweets and a petition on Change.org to reverse the update, which has gotten over 680,000 signatures. The update now combines chats and stories into an inclusive ‘friends’ feed and a separate discover feed which features publishers and celebrity stories. A fake tweet circulated regarding the redesign, claiming that Snapchat will reverse the changes if the tweet gets more than 50,000 retweets. The tweet was shared 1.3 million times as of Sunday and is now the sixth most retweeted post of all time. ___ In response to the backlash, a Snapchat spokeswoman said “updates as big as this one can take a little getting used to, but we hope the community will enjoy it once they settle in.” ___ Photo: Snapchat
Snapchat’s most recent software update has generated a negative response from users, many of whom vocalized their opinions through tweets an...
![Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!](https://pics.me.me/tggaacttgaaggaggaactaaaagaagcggcttctaataaattctatagctaaggtcatcgaa-ggttacttattttttactttatttaggttgcctgatattcacttagtctggcctgctaaacatg-gacttttccagtatgcgtgg-30721976.png)
Memes, News, and American: (AP Photo/Carolyn Kaster
The Democrats still
haven't gotten the
memo. Ihe people oT
the United States
delivered an
American first
president in Donald j
J. Trump, and that's
exactly what he's
trying to give them.
-Katrina Pierson
FOX
NEWS
channe
On "Justice," former President Donald J. Trump spokesperson Katrina Pierson commented on immigration reform.
On "Justice," former President Donald J. Trump spokesperson Katrina Pierson commented on immigration reform.
