Poet
Poet

Poet

How Much
How Much

How Much

For You
For You

For You

Paramedic
Paramedic

Paramedic

bedding
 bedding

bedding

momentous
momentous

momentous

interest
interest

interest

seemingly
seemingly

seemingly

payed
payed

payed

artistic
artistic

artistic

🔥 | Latest

Bae, Crazy, and Lol: Yasssss Daddy! Good Peen Will Make A Woman Do Some Crazy Sh*t @balleralert Yasssss Daddy! Good Peen Will Make A Woman Do Some Crazy Sh*t- blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Ladies, I know I’m not the only one that has gotten some peen and did some of the craziest sh*ts ever. Like every time you and bae have a rendezvous, he hits every spot just right. “When He F*ck Me Good, I Take His A$$ To Red Lobster” type of sex. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Bae’s sex is so amazing that every time he leaves home, you calling like, “Where you at?” “You coming home soon?” Hell, you don’t want the next chick getting what you receive at home. You want to make sure he brings that a$$ home every night. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Great sex will have you trying to have his baby. You get so wrapped up in the sex night after night and find yourself screaming, “I want to have your baby!” Most of the time it comes out because you don’t him to stop and you feel him pulsate inside of you. (Don’t try and front in the comments like you haven’t done it. If not, he’s coming so watch out lol). ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Good peen will have you singing all kinds of love songs. You get so wrapped up that you can’t believe the things you are doing. His peen got you feeling like a straight sap lol. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ A good man with good peen is often hard to come by. But when he does come around, you better hold on and bring the freak out every chance you get. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ What’s the craziest thing you have ever done after getting some good peen?
Bae, Crazy, and Lol: Yasssss Daddy! Good Peen Will Make
 A Woman Do Some Crazy Sh*t
 @balleralert
Yasssss Daddy! Good Peen Will Make A Woman Do Some Crazy Sh*t- blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Ladies, I know I’m not the only one that has gotten some peen and did some of the craziest sh*ts ever. Like every time you and bae have a rendezvous, he hits every spot just right. “When He F*ck Me Good, I Take His A$$ To Red Lobster” type of sex. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Bae’s sex is so amazing that every time he leaves home, you calling like, “Where you at?” “You coming home soon?” Hell, you don’t want the next chick getting what you receive at home. You want to make sure he brings that a$$ home every night. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Great sex will have you trying to have his baby. You get so wrapped up in the sex night after night and find yourself screaming, “I want to have your baby!” Most of the time it comes out because you don’t him to stop and you feel him pulsate inside of you. (Don’t try and front in the comments like you haven’t done it. If not, he’s coming so watch out lol). ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Good peen will have you singing all kinds of love songs. You get so wrapped up that you can’t believe the things you are doing. His peen got you feeling like a straight sap lol. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ A good man with good peen is often hard to come by. But when he does come around, you better hold on and bring the freak out every chance you get. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ What’s the craziest thing you have ever done after getting some good peen?

Yasssss Daddy! Good Peen Will Make A Woman Do Some Crazy Sh*t- blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Ladies, I know I’m not the only one tha...

Being Alone, Life, and Love: To the undocumented immigrant contemplating suicide, I've been in your shoes. I remember wanting to take my life at T/ because l felt alone, scared & my life was filled with uncertainty. Here l am 9 years later at 26. You deserve to dream but most importantly you deserve to live. Iván Ceja You deserve to live Repost @IvanCejatv: “*With everything going on and what some of you that I’ve checked in with have expressed, I felt the need to repost this message I shared a while back. I feel the weight of everything going on and I just want you to know that you are so powerful and so worthy. That’s why the opposition does so much to bring you down, but it is my hope that you will continue to rise up even if it’s one day at a time. Do so at your own pace. Only you know what you need and I hope you find it, but also know that we have each other and there’s nothing wrong with asking for help. - . . “There are times when I still feel alone, scared and my life is still filled with uncertainty. Sometimes it feels like it hasn’t gotten any better truth be told, but I am stronger today and I’m better able to tackle the obstacles that come with being undocumented in the U.S. . . It can feel like a never ending cycle of having to validate your humanity because being human isn’t enough for some people. But still you will rise above and even higher when you realize that legislation that never passes and the headlines that call you illegal do not define you. . . You might feel alone, but I want you to know that YOU ARE NOT ALONE. You might be a lot of other things, but not alone. I know undocumented immigrants from across the country - literally every state - that want to be your friend. Let me know and I will introduce you to them. . . If you are still reading this, then chances are that you can relate. Perhaps you are not as misunderstood as you thought. Nonetheless, I believe you matter and the fact that you have made it this far just goes to show that you are stronger than you give yourself credit for. . . You deserve to dream, but most importantly you deserve to live. You deserve to live. Make the call if you need to. It is brave to ask for help.” Suicide Prevention Lifeline: 1-800-273-8255 . . dreamact immigration undocumented dreamer daca cleandreamact immigrants dreamers immigrant suicide mentalhealth health support love
Being Alone, Life, and Love: To the undocumented immigrant
 contemplating suicide, I've been in your
 shoes. I remember wanting to take my
 life at T/ because l felt alone, scared &
 my life was filled with uncertainty. Here l
 am 9 years later at 26. You deserve to
 dream but most importantly you
 deserve to live.
 Iván Ceja
You deserve to live Repost @IvanCejatv: “*With everything going on and what some of you that I’ve checked in with have expressed, I felt the need to repost this message I shared a while back. I feel the weight of everything going on and I just want you to know that you are so powerful and so worthy. That’s why the opposition does so much to bring you down, but it is my hope that you will continue to rise up even if it’s one day at a time. Do so at your own pace. Only you know what you need and I hope you find it, but also know that we have each other and there’s nothing wrong with asking for help. - . . “There are times when I still feel alone, scared and my life is still filled with uncertainty. Sometimes it feels like it hasn’t gotten any better truth be told, but I am stronger today and I’m better able to tackle the obstacles that come with being undocumented in the U.S. . . It can feel like a never ending cycle of having to validate your humanity because being human isn’t enough for some people. But still you will rise above and even higher when you realize that legislation that never passes and the headlines that call you illegal do not define you. . . You might feel alone, but I want you to know that YOU ARE NOT ALONE. You might be a lot of other things, but not alone. I know undocumented immigrants from across the country - literally every state - that want to be your friend. Let me know and I will introduce you to them. . . If you are still reading this, then chances are that you can relate. Perhaps you are not as misunderstood as you thought. Nonetheless, I believe you matter and the fact that you have made it this far just goes to show that you are stronger than you give yourself credit for. . . You deserve to dream, but most importantly you deserve to live. You deserve to live. Make the call if you need to. It is brave to ask for help.” Suicide Prevention Lifeline: 1-800-273-8255 . . dreamact immigration undocumented dreamer daca cleandreamact immigrants dreamers immigrant suicide mentalhealth health support love

You deserve to live Repost @IvanCejatv: “*With everything going on and what some of you that I’ve checked in with have expressed, I felt the...

Energy, Fuck You, and Fucking: O 63% 08:42 charmcitywire.com I'm All In On This Guy Selling Energy Drinks Filled With Crystal Meth And Gasoline Out Of His Tree Fort Humor, News_May 6, 2015 at 2:24 pm by Zach ENERO DRINK NERGY Boone County Sheriff's Office 72-year-old Jasper June, of Boone County, West Virginia was arrested on charges of making and selling his homemade energy drinks containing meth out of his tree fort. (A fucking tree fort, how great is this guy)? When police showed up, they found June wearing an adult diaper and browsing through an Arabic porno magazine. Police tested 25 00 AT&T 08:43 o 63%! charmcitywire.com bottles of his energy drink, each of which contained meth. Police discovered June's practice after several high school girls had to be hospitalized for internal bleeding after consuming the drinks. This is what June had to say about the drinks: They're just energy drinks like Rockstar or Monster. It's not meth in there. It's just lemonade, caffeine, sugar and a couple drops of gasoline. I swear to God I didn't put meth in there." He then back tracked and went with this version: "Okay,Iput just a little meth in there to get them addicted and keep customers coming back. I know they'll all testify against me so let me make something else clear: I pissed in every bottle." Well if there's one thing we know, it's that these energy drinks are gonna work. Nothing will get you jacked up like a little meth, gasoline, and human urine. Bottom line is when you buy a product, you 08:43 O 63% charmcitywire.com want it to work. And if these little high school bitches want to run and be narks after purchasing a quality working energy drink for the bargain price of only 20 bucks, then I have no words. Plus, if you're them, and you see this guy, selling this drink, and you still buy it, that's on you. I just love everything about Jasper June and his retail business. He read pornos in a foreign language while wearing his diaper, and when police ask about his product, he is adamant that there Is no meth in there, only gasoline. And then whern forced to confess, he throws a big fuck you in there and tells everyone these girls drank his piss too lcing on the cake. PS- How perfect is this guy's name and where he's from? Jasper June from Boone County, West Virginia selling meth out of his tree fort Follow @zachhagerman Via Share: Tweet Like 551 Author: Zach Tree Fort Piss and Meth Energy Drinks for 20.00. Takers?
Energy, Fuck You, and Fucking: O 63%
 08:42
 charmcitywire.com
 I'm All In On This Guy
 Selling Energy Drinks
 Filled With Crystal
 Meth And Gasoline
 Out Of His Tree Fort
 Humor, News_May 6, 2015 at 2:24 pm by Zach
 ENERO
 DRINK
 NERGY
 Boone County Sheriff's Office
 72-year-old Jasper June, of Boone County, West
 Virginia was arrested on charges of making and
 selling his homemade energy drinks containing
 meth out of his tree fort. (A fucking tree fort, how
 great is this guy)? When police showed up, they
 found June wearing an adult diaper and browsing
 through an Arabic porno magazine. Police tested 25

 00 AT&T
 08:43
 o 63%!
 charmcitywire.com
 bottles of his energy drink, each of which contained
 meth.
 Police discovered June's practice after several high
 school girls had to be hospitalized for internal
 bleeding after consuming the drinks.
 This is what June had to say about the drinks:
 They're just energy drinks like Rockstar or
 Monster. It's not meth in there. It's just lemonade,
 caffeine, sugar and a couple drops of gasoline. I
 swear to God I didn't put meth in there."
 He then back tracked and went with this version:
 "Okay,Iput just a little meth in there to get them
 addicted and keep customers coming back. I know
 they'll all testify against me so let me make
 something else clear: I pissed in every bottle."
 Well if there's one thing we know, it's that these
 energy drinks are gonna work. Nothing will get you
 jacked up like a little meth, gasoline, and human
 urine. Bottom line is when you buy a product, you

 08:43
 O 63%
 charmcitywire.com
 want it to work. And if these little high school bitches
 want to run and be narks after purchasing a quality
 working energy drink for the bargain price of only 20
 bucks, then I have no words. Plus, if you're them,
 and you see this guy, selling this drink, and you still
 buy it, that's on you.
 I just love everything about Jasper June and his
 retail business. He read pornos in a foreign
 language while wearing his diaper, and when police
 ask about his product, he is adamant that there Is
 no meth in there, only gasoline. And then whern
 forced to confess, he throws a big fuck you in there
 and tells everyone these girls drank his piss too
 lcing on the cake.
 PS- How perfect is this guy's name and where he's
 from? Jasper June from Boone County, West
 Virginia selling meth out of his tree fort
 Follow @zachhagerman
 Via
 Share:
 Tweet
 Like
 551
 Author: Zach
Tree Fort Piss and Meth Energy Drinks for 20.00. Takers?

Tree Fort Piss and Meth Energy Drinks for 20.00. Takers?

Friday, Love, and Memes: 'Black Panther' Breaks Barriers and Records In lts Opening Weekend @balleralert 'Black Panther' Breaks Barriers and Records In Its Opening Weekend - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ RyanCoogler’s 'Black Panther' is setting a tone for Marvel films, creating conversations while breaking several barriers at the same damn time. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ In just the first three-to-four-days of its release, the film earned a whopping $235 million, making it the fifth highest-earning of any film and the highest debut ever for a February film. And let’s get into 31-year-old Oakland native Coogler, who made history for now having the highest-grossing film ever by a black director. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ BlackPanther now holds the biggest solo superhero launch of all-time! It also takes the crown for the biggest non-sequel opening weekend, the biggest Friday through Sunday opening weekend for a long holiday debut, the biggest long holiday opening weekend and the biggest pre-summer opening weekend (there’s actually more). The film has already gotten esteemed praise from critics on Rotten Tomatoes who gave the film a 97 percent. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ We don’t really have to say much, the movie is a one-of-kind BlackMagic masterpiece. We fell in love with our righteous all-Black cast which starred ChadwickBoseman, LupitaNyongo, MichaelBJordan, AngelaBassett, DanaiGurira, DanielKaluuya, ForestWhitaker, SterlingKBrown, FlorenceKaumba, WinstonDuke and now beloved breakout star LetitiaWright. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ 'Black Panther' changed the Marvel superhero game and as you can see by the numbers and audience involvement, we’re loving every minute of it. WakandaForever
Friday, Love, and Memes: 'Black Panther' Breaks
 Barriers and Records In lts
 Opening Weekend
 @balleralert
'Black Panther' Breaks Barriers and Records In Its Opening Weekend - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ RyanCoogler’s 'Black Panther' is setting a tone for Marvel films, creating conversations while breaking several barriers at the same damn time. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ In just the first three-to-four-days of its release, the film earned a whopping $235 million, making it the fifth highest-earning of any film and the highest debut ever for a February film. And let’s get into 31-year-old Oakland native Coogler, who made history for now having the highest-grossing film ever by a black director. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ BlackPanther now holds the biggest solo superhero launch of all-time! It also takes the crown for the biggest non-sequel opening weekend, the biggest Friday through Sunday opening weekend for a long holiday debut, the biggest long holiday opening weekend and the biggest pre-summer opening weekend (there’s actually more). The film has already gotten esteemed praise from critics on Rotten Tomatoes who gave the film a 97 percent. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ We don’t really have to say much, the movie is a one-of-kind BlackMagic masterpiece. We fell in love with our righteous all-Black cast which starred ChadwickBoseman, LupitaNyongo, MichaelBJordan, AngelaBassett, DanaiGurira, DanielKaluuya, ForestWhitaker, SterlingKBrown, FlorenceKaumba, WinstonDuke and now beloved breakout star LetitiaWright. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ 'Black Panther' changed the Marvel superhero game and as you can see by the numbers and audience involvement, we’re loving every minute of it. WakandaForever

'Black Panther' Breaks Barriers and Records In Its Opening Weekend - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ RyanCoogler’s 'Black Pa...

Memes, Money, and Police: Grandmother Finds Grandson's Plans For School Shooting a Day Before Parkland Massacre @balleralert Grandmother Finds Grandson’s Plans For School Shooting a Day Before Parkland Massacre - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Another student was plotting a mass shooting at a Washington state high school but didn’t get away with it because his grandmother turned his plans into police. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On Tuesday, just a day before the Parkland, Fla. high school terror attack, Catherine Katsel-O’Connor called the police after she found notes in her grandson’s journal about shooting students at ACES high school. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ The grandmother says she was alarmed by the evil ideas her grandson Joshua Alexander O’Connor’s kept in his journal. But what shocked her more was the semi-automatic rifle she found in his guitar case. "I'm preparing myself for the school shooting,” the teenager wrote, according to court documents. “I can’t wait. My aim has gotten much more accurate ... I can’t wait to walk into that class and blow all those f--ers away." ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ As soon as authorities found out about the man’s plans they pulled him from his Kamiak High School class and arrested him. While in custody Joshua attempted to run away and kicked one of the police. In the end, police were able to subdue the man. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Joshua has been charged with attempted murder, assault of a police officer and armed robbery because of money he had stolen to fund his attack. His bail was set at $5 million.
Memes, Money, and Police: Grandmother Finds Grandson's
 Plans For School Shooting a Day
 Before Parkland Massacre
 @balleralert
Grandmother Finds Grandson’s Plans For School Shooting a Day Before Parkland Massacre - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Another student was plotting a mass shooting at a Washington state high school but didn’t get away with it because his grandmother turned his plans into police. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On Tuesday, just a day before the Parkland, Fla. high school terror attack, Catherine Katsel-O’Connor called the police after she found notes in her grandson’s journal about shooting students at ACES high school. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ The grandmother says she was alarmed by the evil ideas her grandson Joshua Alexander O’Connor’s kept in his journal. But what shocked her more was the semi-automatic rifle she found in his guitar case. "I'm preparing myself for the school shooting,” the teenager wrote, according to court documents. “I can’t wait. My aim has gotten much more accurate ... I can’t wait to walk into that class and blow all those f--ers away." ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ As soon as authorities found out about the man’s plans they pulled him from his Kamiak High School class and arrested him. While in custody Joshua attempted to run away and kicked one of the police. In the end, police were able to subdue the man. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Joshua has been charged with attempted murder, assault of a police officer and armed robbery because of money he had stolen to fund his attack. His bail was set at $5 million.

Grandmother Finds Grandson’s Plans For School Shooting a Day Before Parkland Massacre - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Anot...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Beautiful, Crazy, and Fresh: sosyebabe What you got made fun of in school for? graatrunk i went into american public school for 6th grade and i pierced someone's scrotum with a fencing foil that was missing the little rubber safety tip on the end by accident in gym and it was middle school so i was promptly nicknamed "The Nut Slayer" and i cried until my parents let me move back to europe and live with my grandparents billsimportantposts I know most people associate LUSH Cosmetics with white girls and bath bombs but products from this beautiful company have faded my scars and stretch marks, completely gotten rid of my acne, fixed my dry skin problems, thickened my eyelashes, laid my edges, made my hair grow like crazy… I can go on and on. I’ve actually never tried the bath bombs, but their skincare and haircare products work magic. Fading Scars - Stretch Marks Organic Therapy Massage Bar Extra Dry Skin King of Skin In-Shower Body Conditioner, Skin Drink Facial Moisturizer, Sultana of Soap Bar, Tender is the Night Massage Bar, Each’s a Peach Massage Bar Acne Fresh Farmacy Solid Cleanser, Eau Roma Toning Water, Full of Grace Serum Bar Thickening Lashes Eyes Right Mascara - Lash Milk Edges R&B Hair Moisturizer (if you put this on your edges before wrapping your hair, they’ll be relaxer-straight when you wake up, lasts about 12 hours), -Dirty Styling Cream (cream-based edge control with a matte finish, no more shiny or crunchy edges) -Hair Growth NEW! Shampoo Bar, Retread Hair Conditioner FACE - HAIR STUFF Magical Moringa Facial Moisturizer Oh my lordy. Let me tell y'all about this stuff. It’s marketed as a moisturizer but I use it as a primer because when you put this on your face, it’s completely matte. Like completely. All day. And it will lock your makeup in place like no other. You can sweat in it, swim in it, whatever. Shit won’t budge. Ever. Jason & the Argan Oil Shampoo Bar Amazing for volumizing. It made the three bundles in my head look more like five when I used this thing the first time, I kid you not. Also gives your hair a really natural shine. I only use it when I really need a volume boost, otherwise it’s just too much. No Drought Dry Shampoo If you have a weave, you need this stuff. Period. A lot of times, the natural oils in our scalps (referring to my fellow black women here) are too heavy for Brazilian, Peruvian, etc hair, and so it’s easy for weave to get weighed down between washes. Shake this stuff in your hair, brush it out - bam, flow city. ( more in the comments
Beautiful, Crazy, and Fresh: sosyebabe
 What you got made fun of in school for?
 graatrunk
 i went into american public school for 6th
 grade and i pierced someone's scrotum with a
 fencing foil that was missing the little rubber
 safety tip on the end by accident in gym
 and it was middle school so i was promptly
 nicknamed "The Nut Slayer" and i cried until
 my parents let me move back to europe and
 live with my grandparents
billsimportantposts I know most people associate LUSH Cosmetics with white girls and bath bombs but products from this beautiful company have faded my scars and stretch marks, completely gotten rid of my acne, fixed my dry skin problems, thickened my eyelashes, laid my edges, made my hair grow like crazy… I can go on and on. I’ve actually never tried the bath bombs, but their skincare and haircare products work magic. Fading Scars - Stretch Marks Organic Therapy Massage Bar Extra Dry Skin King of Skin In-Shower Body Conditioner, Skin Drink Facial Moisturizer, Sultana of Soap Bar, Tender is the Night Massage Bar, Each’s a Peach Massage Bar Acne Fresh Farmacy Solid Cleanser, Eau Roma Toning Water, Full of Grace Serum Bar Thickening Lashes Eyes Right Mascara - Lash Milk Edges R&B Hair Moisturizer (if you put this on your edges before wrapping your hair, they’ll be relaxer-straight when you wake up, lasts about 12 hours), -Dirty Styling Cream (cream-based edge control with a matte finish, no more shiny or crunchy edges) -Hair Growth NEW! Shampoo Bar, Retread Hair Conditioner FACE - HAIR STUFF Magical Moringa Facial Moisturizer Oh my lordy. Let me tell y'all about this stuff. It’s marketed as a moisturizer but I use it as a primer because when you put this on your face, it’s completely matte. Like completely. All day. And it will lock your makeup in place like no other. You can sweat in it, swim in it, whatever. Shit won’t budge. Ever. Jason & the Argan Oil Shampoo Bar Amazing for volumizing. It made the three bundles in my head look more like five when I used this thing the first time, I kid you not. Also gives your hair a really natural shine. I only use it when I really need a volume boost, otherwise it’s just too much. No Drought Dry Shampoo If you have a weave, you need this stuff. Period. A lot of times, the natural oils in our scalps (referring to my fellow black women here) are too heavy for Brazilian, Peruvian, etc hair, and so it’s easy for weave to get weighed down between washes. Shake this stuff in your hair, brush it out - bam, flow city. ( more in the comments

billsimportantposts I know most people associate LUSH Cosmetics with white girls and bath bombs but products from this beautiful company hav...