Poet
Poet

Poet

How Much
How Much

How Much

For You
For You

For You

Paramedic
Paramedic

Paramedic

bedding
 bedding

bedding

momentous
momentous

momentous

interest
interest

interest

seemingly
seemingly

seemingly

payed
payed

payed

artistic
artistic

artistic

🔥 | Latest

Memes, Money, and Police: Grandmother Finds Grandson's Plans For School Shooting a Day Before Parkland Massacre @balleralert Grandmother Finds Grandson’s Plans For School Shooting a Day Before Parkland Massacre - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Another student was plotting a mass shooting at a Washington state high school but didn’t get away with it because his grandmother turned his plans into police. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On Tuesday, just a day before the Parkland, Fla. high school terror attack, Catherine Katsel-O’Connor called the police after she found notes in her grandson’s journal about shooting students at ACES high school. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ The grandmother says she was alarmed by the evil ideas her grandson Joshua Alexander O’Connor’s kept in his journal. But what shocked her more was the semi-automatic rifle she found in his guitar case. "I'm preparing myself for the school shooting,” the teenager wrote, according to court documents. “I can’t wait. My aim has gotten much more accurate ... I can’t wait to walk into that class and blow all those f--ers away." ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ As soon as authorities found out about the man’s plans they pulled him from his Kamiak High School class and arrested him. While in custody Joshua attempted to run away and kicked one of the police. In the end, police were able to subdue the man. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Joshua has been charged with attempted murder, assault of a police officer and armed robbery because of money he had stolen to fund his attack. His bail was set at $5 million.
Memes, Money, and Police: Grandmother Finds Grandson's
 Plans For School Shooting a Day
 Before Parkland Massacre
 @balleralert
Grandmother Finds Grandson’s Plans For School Shooting a Day Before Parkland Massacre - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Another student was plotting a mass shooting at a Washington state high school but didn’t get away with it because his grandmother turned his plans into police. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On Tuesday, just a day before the Parkland, Fla. high school terror attack, Catherine Katsel-O’Connor called the police after she found notes in her grandson’s journal about shooting students at ACES high school. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ The grandmother says she was alarmed by the evil ideas her grandson Joshua Alexander O’Connor’s kept in his journal. But what shocked her more was the semi-automatic rifle she found in his guitar case. "I'm preparing myself for the school shooting,” the teenager wrote, according to court documents. “I can’t wait. My aim has gotten much more accurate ... I can’t wait to walk into that class and blow all those f--ers away." ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ As soon as authorities found out about the man’s plans they pulled him from his Kamiak High School class and arrested him. While in custody Joshua attempted to run away and kicked one of the police. In the end, police were able to subdue the man. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Joshua has been charged with attempted murder, assault of a police officer and armed robbery because of money he had stolen to fund his attack. His bail was set at $5 million.

Grandmother Finds Grandson’s Plans For School Shooting a Day Before Parkland Massacre - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Anot...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Beautiful, Crazy, and Fresh: sosyebabe What you got made fun of in school for? graatrunk i went into american public school for 6th grade and i pierced someone's scrotum with a fencing foil that was missing the little rubber safety tip on the end by accident in gym and it was middle school so i was promptly nicknamed "The Nut Slayer" and i cried until my parents let me move back to europe and live with my grandparents billsimportantposts I know most people associate LUSH Cosmetics with white girls and bath bombs but products from this beautiful company have faded my scars and stretch marks, completely gotten rid of my acne, fixed my dry skin problems, thickened my eyelashes, laid my edges, made my hair grow like crazy… I can go on and on. I’ve actually never tried the bath bombs, but their skincare and haircare products work magic. Fading Scars - Stretch Marks Organic Therapy Massage Bar Extra Dry Skin King of Skin In-Shower Body Conditioner, Skin Drink Facial Moisturizer, Sultana of Soap Bar, Tender is the Night Massage Bar, Each’s a Peach Massage Bar Acne Fresh Farmacy Solid Cleanser, Eau Roma Toning Water, Full of Grace Serum Bar Thickening Lashes Eyes Right Mascara - Lash Milk Edges R&B Hair Moisturizer (if you put this on your edges before wrapping your hair, they’ll be relaxer-straight when you wake up, lasts about 12 hours), -Dirty Styling Cream (cream-based edge control with a matte finish, no more shiny or crunchy edges) -Hair Growth NEW! Shampoo Bar, Retread Hair Conditioner FACE - HAIR STUFF Magical Moringa Facial Moisturizer Oh my lordy. Let me tell y'all about this stuff. It’s marketed as a moisturizer but I use it as a primer because when you put this on your face, it’s completely matte. Like completely. All day. And it will lock your makeup in place like no other. You can sweat in it, swim in it, whatever. Shit won’t budge. Ever. Jason & the Argan Oil Shampoo Bar Amazing for volumizing. It made the three bundles in my head look more like five when I used this thing the first time, I kid you not. Also gives your hair a really natural shine. I only use it when I really need a volume boost, otherwise it’s just too much. No Drought Dry Shampoo If you have a weave, you need this stuff. Period. A lot of times, the natural oils in our scalps (referring to my fellow black women here) are too heavy for Brazilian, Peruvian, etc hair, and so it’s easy for weave to get weighed down between washes. Shake this stuff in your hair, brush it out - bam, flow city. ( more in the comments
Beautiful, Crazy, and Fresh: sosyebabe
 What you got made fun of in school for?
 graatrunk
 i went into american public school for 6th
 grade and i pierced someone's scrotum with a
 fencing foil that was missing the little rubber
 safety tip on the end by accident in gym
 and it was middle school so i was promptly
 nicknamed "The Nut Slayer" and i cried until
 my parents let me move back to europe and
 live with my grandparents
billsimportantposts I know most people associate LUSH Cosmetics with white girls and bath bombs but products from this beautiful company have faded my scars and stretch marks, completely gotten rid of my acne, fixed my dry skin problems, thickened my eyelashes, laid my edges, made my hair grow like crazy… I can go on and on. I’ve actually never tried the bath bombs, but their skincare and haircare products work magic. Fading Scars - Stretch Marks Organic Therapy Massage Bar Extra Dry Skin King of Skin In-Shower Body Conditioner, Skin Drink Facial Moisturizer, Sultana of Soap Bar, Tender is the Night Massage Bar, Each’s a Peach Massage Bar Acne Fresh Farmacy Solid Cleanser, Eau Roma Toning Water, Full of Grace Serum Bar Thickening Lashes Eyes Right Mascara - Lash Milk Edges R&B Hair Moisturizer (if you put this on your edges before wrapping your hair, they’ll be relaxer-straight when you wake up, lasts about 12 hours), -Dirty Styling Cream (cream-based edge control with a matte finish, no more shiny or crunchy edges) -Hair Growth NEW! Shampoo Bar, Retread Hair Conditioner FACE - HAIR STUFF Magical Moringa Facial Moisturizer Oh my lordy. Let me tell y'all about this stuff. It’s marketed as a moisturizer but I use it as a primer because when you put this on your face, it’s completely matte. Like completely. All day. And it will lock your makeup in place like no other. You can sweat in it, swim in it, whatever. Shit won’t budge. Ever. Jason & the Argan Oil Shampoo Bar Amazing for volumizing. It made the three bundles in my head look more like five when I used this thing the first time, I kid you not. Also gives your hair a really natural shine. I only use it when I really need a volume boost, otherwise it’s just too much. No Drought Dry Shampoo If you have a weave, you need this stuff. Period. A lot of times, the natural oils in our scalps (referring to my fellow black women here) are too heavy for Brazilian, Peruvian, etc hair, and so it’s easy for weave to get weighed down between washes. Shake this stuff in your hair, brush it out - bam, flow city. ( more in the comments

billsimportantposts I know most people associate LUSH Cosmetics with white girls and bath bombs but products from this beautiful company hav...

Being Alone, Life, and Memes: To the undocumented immigrant contemplating suicide, I've been in your shoes. I remember wanting to take my life at 17 because l felt alone, scared & my life was filled with uncertainty. Here l am 9 years later at 26. You deserve to dream but most importantly you deserve to live. Iván Ceja Repost @IvanCejatv: “There are times when I still feel alone, scared and my life is still filled with uncertainty. Sometimes it feels like it hasn’t gotten any better truth be told, but I am stronger today and I’m better able to tackle the obstacles that come with being undocumented in the U.S. It can feel like a never ending cycle of having to validate your humanity because being human isn’t enough for some people. But still you will rise above and even higher when you realize that legislation that never passes and the headlines that call you illegal do not define you. You might feel alone, but I want you to know that YOU ARE NOT ALONE. You might be a lot of other things, but not alone. I know undocumented immigrants from across the country - literally every state - that want to be your friend. Let me know and I will introduce you to them. If you are still reading this, then chances are that you can relate. Perhaps you are not as misunderstood as you thought. Nonetheless, I believe you matter and the fact that you have made it this far just goes to show that you are stronger than you give yourself credit for. You deserve to dream, but most importantly you deserve to live. You deserve to live. Make the call if you need to. It is brave to ask for help.” Suicide Prevention Lifeline: 1-800-273-8255
Being Alone, Life, and Memes: To the undocumented immigrant
 contemplating suicide, I've been in your
 shoes. I remember wanting to take my
 life at 17 because l felt alone, scared &
 my life was filled with uncertainty. Here l
 am 9 years later at 26. You deserve to
 dream but most importantly you
 deserve to live.
 Iván Ceja
Repost @IvanCejatv: “There are times when I still feel alone, scared and my life is still filled with uncertainty. Sometimes it feels like it hasn’t gotten any better truth be told, but I am stronger today and I’m better able to tackle the obstacles that come with being undocumented in the U.S. It can feel like a never ending cycle of having to validate your humanity because being human isn’t enough for some people. But still you will rise above and even higher when you realize that legislation that never passes and the headlines that call you illegal do not define you. You might feel alone, but I want you to know that YOU ARE NOT ALONE. You might be a lot of other things, but not alone. I know undocumented immigrants from across the country - literally every state - that want to be your friend. Let me know and I will introduce you to them. If you are still reading this, then chances are that you can relate. Perhaps you are not as misunderstood as you thought. Nonetheless, I believe you matter and the fact that you have made it this far just goes to show that you are stronger than you give yourself credit for. You deserve to dream, but most importantly you deserve to live. You deserve to live. Make the call if you need to. It is brave to ask for help.” Suicide Prevention Lifeline: 1-800-273-8255

Repost @IvanCejatv: “There are times when I still feel alone, scared and my life is still filled with uncertainty. Sometimes it feels like i...

Philadelphia 76ers, Basketball, and Colin Kaepernick: James Harden Pays Meek Mill A Visit In Jail, Says He's In High Spirits @balleralert JamesHarden Pays MeekMill A Visit In Jail, Says He's In High Spirits - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Even behind bars, rapper Meek Mill is still receiving loads of support from fans, family, and even close friends. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On Tuesday, December 26th, Houston Rockets player James Harden paid a visit to Mill at the State Correctional Institution, located in Chester, PA-and, from what he says, the Philly MC is actually holding up just fine. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “Got a chance to see my bro meekmill today. His spirit is high and hopefully, we can get him out by February,” Harden wrote in his recent Instagram story. He then went on to relay a message that Mill wanted to tell his supporters, regarding some possible music projects on the way. “Told me to tell y’all when he gets out he got some [heat] for y’all.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ In Mill’s honor, TMZ reported that sources close to Harden told TMZ Sports that the NBA superstar had also gotten some ‘Free Meek’ sneakers custom made and would be wearing them on the basketball court when the Rockets play the Celtics, this Thursday. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Though, as of now, it is unclear as to when and if Mill will be coming home anytime soon, it’s great to know that many are still standing with him during this difficult time. Joel Embiid and Michael Rubin, 76ers owner, visited Mill back in November. Colin Kaepernick also spoke with the rapper and said that he was very humbled by everyone’s overwhelming amount of support. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ However, this isn’t Mill’s first big run-in with the law. The 30-year-old has had a troublesome past, but we’re hoping that things will get back on track for the better… at least for his sake. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀
Philadelphia 76ers, Basketball, and Colin Kaepernick: James Harden Pays Meek Mill A
 Visit In Jail, Says He's In High
 Spirits
 @balleralert
JamesHarden Pays MeekMill A Visit In Jail, Says He's In High Spirits - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Even behind bars, rapper Meek Mill is still receiving loads of support from fans, family, and even close friends. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ On Tuesday, December 26th, Houston Rockets player James Harden paid a visit to Mill at the State Correctional Institution, located in Chester, PA-and, from what he says, the Philly MC is actually holding up just fine. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ “Got a chance to see my bro meekmill today. His spirit is high and hopefully, we can get him out by February,” Harden wrote in his recent Instagram story. He then went on to relay a message that Mill wanted to tell his supporters, regarding some possible music projects on the way. “Told me to tell y’all when he gets out he got some [heat] for y’all.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ In Mill’s honor, TMZ reported that sources close to Harden told TMZ Sports that the NBA superstar had also gotten some ‘Free Meek’ sneakers custom made and would be wearing them on the basketball court when the Rockets play the Celtics, this Thursday. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Though, as of now, it is unclear as to when and if Mill will be coming home anytime soon, it’s great to know that many are still standing with him during this difficult time. Joel Embiid and Michael Rubin, 76ers owner, visited Mill back in November. Colin Kaepernick also spoke with the rapper and said that he was very humbled by everyone’s overwhelming amount of support. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ However, this isn’t Mill’s first big run-in with the law. The 30-year-old has had a troublesome past, but we’re hoping that things will get back on track for the better… at least for his sake. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀

JamesHarden Pays MeekMill A Visit In Jail, Says He's In High Spirits - blogged by: @ashleytearra ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Even behind bars, rapper Me...