Carole
Carole

Carole

President Now
President Now

President Now

I Shit You Knot
I Shit You Knot

I Shit You Knot

Caitlyn Jenner Jokes
Caitlyn Jenner Jokes

Caitlyn Jenner Jokes

Littled
Littled

Littled

mistake
 mistake

mistake

willie
willie

willie

animism
animism

animism

there
there

there

ifs
ifs

ifs

🔥 | Latest

Be Like, Family, and Friends: EVEN BEFORE I STARTED I KNEW I-WOULD WIN I KNEW I WOULD WIN Do you feel like you were meant to be successful since day one? 🤔 There is no magic bullet. There is no one-size-fits-all prescription to succeed. But there are certain qualities that incredibly successful people share...especially those who make a significant impact on the lives of other people in the process. Check if these apply to you👇 ✔️Every successful person answers the question, "Can you make the choice that your happiness will come from the success of others?" with a resounding "Yes!" ✔️You relentlessly seek new experiences. To succeed, you want to be able to regulate your impulses while also having the imagination to see what the future would be like if you tried something new. So go ahead. Embrace your curiosity. You'll be healthier, you'll have more friends, and you'll be generally more satisfied with life. ✔️You don't think work-life balance, you just think LIFE. Your business is your life, just like your life is your business, which is also true for family, friends, and interests. So there is no separation because all those things make you who you are. Incredibly successful people find ways to include family instead of ways to exclude work. They find ways to include interests, hobbies, passions, and personal values in their daily business lives. If you can't, you're not living… you're just working. ✔️You ignore the 40-hour workweek hype. Studies show that working more than 40 hours a week decreases productivity. AAAIGHT… Successful people work smarter, sure, but they also outwork their competition. There will always be people who are smarter and more talented than we are. Successful people simply want it more. They're ruthless, especially with themselves. They work smarter and they also work harder. That's the real secret of their success. 🔥 - Do you feel related to any of these? Let me know in the comments below!👇 - winner success millionairementor
Be Like, Family, and Friends: EVEN BEFORE I STARTED
 I KNEW I-WOULD WIN
I KNEW I WOULD WIN Do you feel like you were meant to be successful since day one? 🤔 There is no magic bullet. There is no one-size-fits-all prescription to succeed. But there are certain qualities that incredibly successful people share...especially those who make a significant impact on the lives of other people in the process. Check if these apply to you👇 ✔️Every successful person answers the question, "Can you make the choice that your happiness will come from the success of others?" with a resounding "Yes!" ✔️You relentlessly seek new experiences. To succeed, you want to be able to regulate your impulses while also having the imagination to see what the future would be like if you tried something new. So go ahead. Embrace your curiosity. You'll be healthier, you'll have more friends, and you'll be generally more satisfied with life. ✔️You don't think work-life balance, you just think LIFE. Your business is your life, just like your life is your business, which is also true for family, friends, and interests. So there is no separation because all those things make you who you are. Incredibly successful people find ways to include family instead of ways to exclude work. They find ways to include interests, hobbies, passions, and personal values in their daily business lives. If you can't, you're not living… you're just working. ✔️You ignore the 40-hour workweek hype. Studies show that working more than 40 hours a week decreases productivity. AAAIGHT… Successful people work smarter, sure, but they also outwork their competition. There will always be people who are smarter and more talented than we are. Successful people simply want it more. They're ruthless, especially with themselves. They work smarter and they also work harder. That's the real secret of their success. 🔥 - Do you feel related to any of these? Let me know in the comments below!👇 - winner success millionairementor

I KNEW I WOULD WIN Do you feel like you were meant to be successful since day one? 🤔 There is no magic bullet. There is no one-size-fits-all...

Bad, Bless Up, and Bodies : Invest in tennis balls, they have a high return rate @DrSmashlove Reddit ulyerawizzardarry Ladies cot dammit if ya man take a dive down under and hit ya Nani with that impeccable TungWerk ®️ make a lil eye contact. U feel me? Look him in the eye while he working, he dutiful. It ain’t gotta be a staring contest just that lil belly crunchie where u lean up for a sec with that drooly grin 🤤 before laying back down and clutching ya own bresstassiss again lol. The look in the eye say “I am validating your efforts, which are appreciated. Go Head with that whirlwind devil tung boy who raised u? Is u half Man half reptile with that tornado tung? U tryina eff around and make me fall in love? YOU 👏 DONT 👏 WANT 👏 ME 👏 TO 👏 FALL 👏 IN 👏LOVE 👏THAT’S 👏WHEN 👏 THE 👏 CRAZY 👏 COME 👏 OUT 👏 NOT 👏 THE 👏 GOOD 👏 CRAZY 👏 BUT 👏 THE 👏 BAD CRAZY. 👏BOI...imma have to ohhhghhhhhh ggggahhhhhh” *digs manicure nails into scalp* “I ahhhhhhh yesyesyesyesyes DON’T STOP FUUUUUUUUUUUUUUU 😩” — You feel me? That interaction is clutch. I be seeing some of u criminals tho bruv 😂 - I start going down under and y’all wanna close ya eyes and play out a whole separate movie in ya head. How do I know what movie dat is? Maybe it’s me on a snowy mountain top wearing only a fur loin cloth riding a unicorn with my hair blowing in the arctic wind (I don’t have long hair and anyway my hair don’t blow but bear with me lmao) or maybe it’s another movie entirely that I ain’t even in!? “Well smash now I KNOW you don’t know as much as women as you purport to...some women can’t bust unless they close their eyes and go to a happy place STOP 🛑 TRYING 🛑 TO 🛑 CONTROL 🛑 OUR 🛑 BODIES.” Whoa derr ma. Now u doing too much. U free to go to a happy place, just give a brother a glance! U feel me? A small token of your appreciation. Inside every man is a little part of him that’s a hurt lil boy who need reinforcement. If u think u with some super macho lookin a$$ boy who ain’t got this lil part of him that just mean he good at hiding it but he likely got the ultimate mommy-daddy issues that ain’t came out yet jus wait on it 😂. For the rest of u, LOOK HIM IN THE EYE - to be a good plant manager u gotta be appreciative of the pipe layer so he keep doing a good job BLESS UP 🤗😍😂
Bad, Bless Up, and Bodies : Invest in tennis balls, they have a high
 return rate
 @DrSmashlove
 Reddit ulyerawizzardarry
Ladies cot dammit if ya man take a dive down under and hit ya Nani with that impeccable TungWerk ®️ make a lil eye contact. U feel me? Look him in the eye while he working, he dutiful. It ain’t gotta be a staring contest just that lil belly crunchie where u lean up for a sec with that drooly grin 🤤 before laying back down and clutching ya own bresstassiss again lol. The look in the eye say “I am validating your efforts, which are appreciated. Go Head with that whirlwind devil tung boy who raised u? Is u half Man half reptile with that tornado tung? U tryina eff around and make me fall in love? YOU 👏 DONT 👏 WANT 👏 ME 👏 TO 👏 FALL 👏 IN 👏LOVE 👏THAT’S 👏WHEN 👏 THE 👏 CRAZY 👏 COME 👏 OUT 👏 NOT 👏 THE 👏 GOOD 👏 CRAZY 👏 BUT 👏 THE 👏 BAD CRAZY. 👏BOI...imma have to ohhhghhhhhh ggggahhhhhh” *digs manicure nails into scalp* “I ahhhhhhh yesyesyesyesyes DON’T STOP FUUUUUUUUUUUUUUU 😩” — You feel me? That interaction is clutch. I be seeing some of u criminals tho bruv 😂 - I start going down under and y’all wanna close ya eyes and play out a whole separate movie in ya head. How do I know what movie dat is? Maybe it’s me on a snowy mountain top wearing only a fur loin cloth riding a unicorn with my hair blowing in the arctic wind (I don’t have long hair and anyway my hair don’t blow but bear with me lmao) or maybe it’s another movie entirely that I ain’t even in!? “Well smash now I KNOW you don’t know as much as women as you purport to...some women can’t bust unless they close their eyes and go to a happy place STOP 🛑 TRYING 🛑 TO 🛑 CONTROL 🛑 OUR 🛑 BODIES.” Whoa derr ma. Now u doing too much. U free to go to a happy place, just give a brother a glance! U feel me? A small token of your appreciation. Inside every man is a little part of him that’s a hurt lil boy who need reinforcement. If u think u with some super macho lookin a$$ boy who ain’t got this lil part of him that just mean he good at hiding it but he likely got the ultimate mommy-daddy issues that ain’t came out yet jus wait on it 😂. For the rest of u, LOOK HIM IN THE EYE - to be a good plant manager u gotta be appreciative of the pipe layer so he keep doing a good job BLESS UP 🤗😍😂

Ladies cot dammit if ya man take a dive down under and hit ya Nani with that impeccable TungWerk ®️ make a lil eye contact. U feel me? Look ...

Bad, Future, and Goals: DO YOUR-FUTURE SELF A FAVOR AND WORK ARD NOW Who you are in the future depends on what you do today. Here are a few vital things you can do today that your future self will thank you for. Take this checklist and do each step thoroughly. Your life will line up like magic. ✔️Invest in yourself! We spend so much time investing in relationships and this is a good thing. But we cannot forget that investment in ourselves is as important. Take some time now. Start investing on bettering yourself to become a better person, it will attract even better thing to your life. ✔️Decide what your values are and live them every day. A person who has a strong set of beliefs and values is a happy and strong person. A person who does not have a clearly defined set of beliefs and values is tossed about in life like a tiny ship on an angry ocean. There is nothing certain to a person like this except the fact that he will be at the mercy of others ✔️Measure your successes by your own definition of “success” Everywhere we are bombarded with images of “success” we are told we are successful if we are thin, rich and have power. Well guess what? There are many people with all of those things and most of those people are completely miserable. ✔️Seek forward progress on the path to your goals. Realize that some goals may take years and others, a lifetime. Keep track of your forward progress and give yourself rewards for making it a little further on your path. ✔️Don’t stop learning. Learning is the best thing you can do to improve your current and future life! Learn a new skill, language, something! ✔️Create good habits. Good habits are the key to all success. Bad habits are the unlocked door to failure. ✔️Understand that wherever you are, you can always make a new start. It is never too late and things are never too far gone. What you have done in the past is in the past and your future is what you make it. All you have to do is plot your course and go! - Good luck! - future success millionairementor
Bad, Future, and Goals: DO YOUR-FUTURE SELF
 A FAVOR AND WORK
 ARD NOW
Who you are in the future depends on what you do today. Here are a few vital things you can do today that your future self will thank you for. Take this checklist and do each step thoroughly. Your life will line up like magic. ✔️Invest in yourself! We spend so much time investing in relationships and this is a good thing. But we cannot forget that investment in ourselves is as important. Take some time now. Start investing on bettering yourself to become a better person, it will attract even better thing to your life. ✔️Decide what your values are and live them every day. A person who has a strong set of beliefs and values is a happy and strong person. A person who does not have a clearly defined set of beliefs and values is tossed about in life like a tiny ship on an angry ocean. There is nothing certain to a person like this except the fact that he will be at the mercy of others ✔️Measure your successes by your own definition of “success” Everywhere we are bombarded with images of “success” we are told we are successful if we are thin, rich and have power. Well guess what? There are many people with all of those things and most of those people are completely miserable. ✔️Seek forward progress on the path to your goals. Realize that some goals may take years and others, a lifetime. Keep track of your forward progress and give yourself rewards for making it a little further on your path. ✔️Don’t stop learning. Learning is the best thing you can do to improve your current and future life! Learn a new skill, language, something! ✔️Create good habits. Good habits are the key to all success. Bad habits are the unlocked door to failure. ✔️Understand that wherever you are, you can always make a new start. It is never too late and things are never too far gone. What you have done in the past is in the past and your future is what you make it. All you have to do is plot your course and go! - Good luck! - future success millionairementor

Who you are in the future depends on what you do today. Here are a few vital things you can do today that your future self will thank you fo...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...