were
were

were

ifs
ifs

ifs

ons
ons

ons

feelings
feelings

feelings

go to
go to

go to

comming
comming

comming

cuteness
cuteness

cuteness

worries
worries

worries

i wonder
i wonder

i wonder

i got
i got

i got

🔥 | Latest

Be Like, Bless Up, and Bruh: My sister's gentle giant German Shepherd wears a bow tie everywhere because it makes people less intimidated and afraid of him. @DrSmashlove Reddit u/tricksy_trixie Say Bruh shout to u pretty a$$ ladies with resting bish face (RBF) bruv I fux with y’all. I fux witchu ladies the long way bruv y’all sexy. I’m talking and u just eyeing me. Scrutinizing me. U feel me? Am I making her mad? Is she disagreeing with me? What is she thinking? I need that. That element of risk. Like u might could reach across the table and break a bottle over my head bruv. That sh!t dangerous to me that’s sexy lol. Scowl at me. U feel me? HANGRY - even tho u just bodied four tacos, a bowl of guac, and a large horchata 😩. I fux with that. And women with RBF do well in business! That’s why women get successful and ppl be like “wow Susan is a bish” NO SHE AINT! SHE JUST GOT SKRONG RBF! “David if you don’t start being reasonable imma stab this pen into your neck. How you gon explain that to ya kids? You could have given us $17,000 more per month for this amazing software but nah. You wanted to die on your sword. Well David, act like a bish you gon DIE LIKE A BISH.” I mean I still remember tryina explain to my mama why my sister crying and my mama already got the chancleta IN HER HAND - RAISED - maybe EEN a wooden spoon in the other - just preparing for that cosmic two-tiered simultaneous SHLAP - SHMACK - CRACK of the spoon handle to end my existence u feel me? “Wow smash what a childhood that explains why you’re like this no wonder.” Ok first of all ...... YES ASF 😂. Y’all could judge my mama all u want to but u can’t have 1-on-1 convo’s with all ya chirren once u have more than three like after that u gotta be efficient and the flip flop - wooden spoon is efficient ASF. All I’m saying is at the end of the day I love my mama and perhaps RBF remind me of her Resting Boutta Whup Dat A$$ Face all I’m saying is for u ladies who are like “MY FRIENDS ALL SAY I HAVE THE WORST RBF LIKE HOW DO I GET RID OF THIS”...don’t 😍😂. As Tupac said, “You are appreciated ☺️”. Now none of u extra-a$$ ladies who follow me DM me talmbout “can I ride the Peepington while slapping u with a sandal and breaking wooden spoons on u zaddy ☺️” I told u I ain’t into being dominated! (Nah but DM me tho if u gon do it 🤤🤫) BLESS UP 😍😂😂😂
Be Like, Bless Up, and Bruh: My sister's gentle giant German Shepherd
 wears a bow tie everywhere because it
 makes people less intimidated and afraid
 of him.
 @DrSmashlove
 Reddit u/tricksy_trixie
Say Bruh shout to u pretty a$$ ladies with resting bish face (RBF) bruv I fux with y’all. I fux witchu ladies the long way bruv y’all sexy. I’m talking and u just eyeing me. Scrutinizing me. U feel me? Am I making her mad? Is she disagreeing with me? What is she thinking? I need that. That element of risk. Like u might could reach across the table and break a bottle over my head bruv. That sh!t dangerous to me that’s sexy lol. Scowl at me. U feel me? HANGRY - even tho u just bodied four tacos, a bowl of guac, and a large horchata 😩. I fux with that. And women with RBF do well in business! That’s why women get successful and ppl be like “wow Susan is a bish” NO SHE AINT! SHE JUST GOT SKRONG RBF! “David if you don’t start being reasonable imma stab this pen into your neck. How you gon explain that to ya kids? You could have given us $17,000 more per month for this amazing software but nah. You wanted to die on your sword. Well David, act like a bish you gon DIE LIKE A BISH.” I mean I still remember tryina explain to my mama why my sister crying and my mama already got the chancleta IN HER HAND - RAISED - maybe EEN a wooden spoon in the other - just preparing for that cosmic two-tiered simultaneous SHLAP - SHMACK - CRACK of the spoon handle to end my existence u feel me? “Wow smash what a childhood that explains why you’re like this no wonder.” Ok first of all ...... YES ASF 😂. Y’all could judge my mama all u want to but u can’t have 1-on-1 convo’s with all ya chirren once u have more than three like after that u gotta be efficient and the flip flop - wooden spoon is efficient ASF. All I’m saying is at the end of the day I love my mama and perhaps RBF remind me of her Resting Boutta Whup Dat A$$ Face all I’m saying is for u ladies who are like “MY FRIENDS ALL SAY I HAVE THE WORST RBF LIKE HOW DO I GET RID OF THIS”...don’t 😍😂. As Tupac said, “You are appreciated ☺️”. Now none of u extra-a$$ ladies who follow me DM me talmbout “can I ride the Peepington while slapping u with a sandal and breaking wooden spoons on u zaddy ☺️” I told u I ain’t into being dominated! (Nah but DM me tho if u gon do it 🤤🤫) BLESS UP 😍😂😂😂

Say Bruh shout to u pretty a$$ ladies with resting bish face (RBF) bruv I fux with y’all. I fux witchu ladies the long way bruv y’all sexy. ...

Bad, Bless Up, and Bodies : Invest in tennis balls, they have a high return rate @DrSmashlove Reddit ulyerawizzardarry Ladies cot dammit if ya man take a dive down under and hit ya Nani with that impeccable TungWerk ®️ make a lil eye contact. U feel me? Look him in the eye while he working, he dutiful. It ain’t gotta be a staring contest just that lil belly crunchie where u lean up for a sec with that drooly grin 🤤 before laying back down and clutching ya own bresstassiss again lol. The look in the eye say “I am validating your efforts, which are appreciated. Go Head with that whirlwind devil tung boy who raised u? Is u half Man half reptile with that tornado tung? U tryina eff around and make me fall in love? YOU 👏 DONT 👏 WANT 👏 ME 👏 TO 👏 FALL 👏 IN 👏LOVE 👏THAT’S 👏WHEN 👏 THE 👏 CRAZY 👏 COME 👏 OUT 👏 NOT 👏 THE 👏 GOOD 👏 CRAZY 👏 BUT 👏 THE 👏 BAD CRAZY. 👏BOI...imma have to ohhhghhhhhh ggggahhhhhh” *digs manicure nails into scalp* “I ahhhhhhh yesyesyesyesyes DON’T STOP FUUUUUUUUUUUUUUU 😩” — You feel me? That interaction is clutch. I be seeing some of u criminals tho bruv 😂 - I start going down under and y’all wanna close ya eyes and play out a whole separate movie in ya head. How do I know what movie dat is? Maybe it’s me on a snowy mountain top wearing only a fur loin cloth riding a unicorn with my hair blowing in the arctic wind (I don’t have long hair and anyway my hair don’t blow but bear with me lmao) or maybe it’s another movie entirely that I ain’t even in!? “Well smash now I KNOW you don’t know as much as women as you purport to...some women can’t bust unless they close their eyes and go to a happy place STOP 🛑 TRYING 🛑 TO 🛑 CONTROL 🛑 OUR 🛑 BODIES.” Whoa derr ma. Now u doing too much. U free to go to a happy place, just give a brother a glance! U feel me? A small token of your appreciation. Inside every man is a little part of him that’s a hurt lil boy who need reinforcement. If u think u with some super macho lookin a$$ boy who ain’t got this lil part of him that just mean he good at hiding it but he likely got the ultimate mommy-daddy issues that ain’t came out yet jus wait on it 😂. For the rest of u, LOOK HIM IN THE EYE - to be a good plant manager u gotta be appreciative of the pipe layer so he keep doing a good job BLESS UP 🤗😍😂
Bad, Bless Up, and Bodies : Invest in tennis balls, they have a high
 return rate
 @DrSmashlove
 Reddit ulyerawizzardarry
Ladies cot dammit if ya man take a dive down under and hit ya Nani with that impeccable TungWerk ®️ make a lil eye contact. U feel me? Look him in the eye while he working, he dutiful. It ain’t gotta be a staring contest just that lil belly crunchie where u lean up for a sec with that drooly grin 🤤 before laying back down and clutching ya own bresstassiss again lol. The look in the eye say “I am validating your efforts, which are appreciated. Go Head with that whirlwind devil tung boy who raised u? Is u half Man half reptile with that tornado tung? U tryina eff around and make me fall in love? YOU 👏 DONT 👏 WANT 👏 ME 👏 TO 👏 FALL 👏 IN 👏LOVE 👏THAT’S 👏WHEN 👏 THE 👏 CRAZY 👏 COME 👏 OUT 👏 NOT 👏 THE 👏 GOOD 👏 CRAZY 👏 BUT 👏 THE 👏 BAD CRAZY. 👏BOI...imma have to ohhhghhhhhh ggggahhhhhh” *digs manicure nails into scalp* “I ahhhhhhh yesyesyesyesyes DON’T STOP FUUUUUUUUUUUUUUU 😩” — You feel me? That interaction is clutch. I be seeing some of u criminals tho bruv 😂 - I start going down under and y’all wanna close ya eyes and play out a whole separate movie in ya head. How do I know what movie dat is? Maybe it’s me on a snowy mountain top wearing only a fur loin cloth riding a unicorn with my hair blowing in the arctic wind (I don’t have long hair and anyway my hair don’t blow but bear with me lmao) or maybe it’s another movie entirely that I ain’t even in!? “Well smash now I KNOW you don’t know as much as women as you purport to...some women can’t bust unless they close their eyes and go to a happy place STOP 🛑 TRYING 🛑 TO 🛑 CONTROL 🛑 OUR 🛑 BODIES.” Whoa derr ma. Now u doing too much. U free to go to a happy place, just give a brother a glance! U feel me? A small token of your appreciation. Inside every man is a little part of him that’s a hurt lil boy who need reinforcement. If u think u with some super macho lookin a$$ boy who ain’t got this lil part of him that just mean he good at hiding it but he likely got the ultimate mommy-daddy issues that ain’t came out yet jus wait on it 😂. For the rest of u, LOOK HIM IN THE EYE - to be a good plant manager u gotta be appreciative of the pipe layer so he keep doing a good job BLESS UP 🤗😍😂

Ladies cot dammit if ya man take a dive down under and hit ya Nani with that impeccable TungWerk ®️ make a lil eye contact. U feel me? Look ...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

Ass, Goals, and Memes: DR YOU WON'T GET WHAT YOU WANT BY SITTING ON YOUR ASS. It’s time to get your sh*t together and start motivating yourself to actually achieve your goals. - Starting something new is hard. It can even be a little terrifying. Maybe you don't know where to start, or maybe you're scared of failure. But the only way you'll ever get anything done is if you just get up and do it. Here's how to conquer those fears, get off your ass, and actually achieve those goals. - Getting off your ass and getting things done is not easy-nor will it ever be-but it doesn't have to be hard. If you have the right plan and attitude, you'll be a lot more likely to succeed. In fact, getting off your ass and doing something is incredibly easy and only requires a few steps: ✔️Find your goal. You don't even have to do anything-just sit and think about what you want to do. ✔️Research. The more research you do, the easier the task in front of you is going to be. Heck, you can do anything if all it takes is following directions. ✔️Set deadlines and stick to them: Setting deadlines is easy, just pick a date. Keeping yourself to them is a bit harder, but you can work a rewards system into it to keep you on track. ✔️Give yourself the time to work. At least 15 minutes a day. That's easy, right? 👀 ✔️Start. Seriously, all you have to do is start into it if you enjoy what you're doing, you'll keep it up. millionairementor
Ass, Goals, and Memes: DR
 YOU WON'T GET
 WHAT YOU WANT
 BY SITTING ON YOUR ASS.
It’s time to get your sh*t together and start motivating yourself to actually achieve your goals. - Starting something new is hard. It can even be a little terrifying. Maybe you don't know where to start, or maybe you're scared of failure. But the only way you'll ever get anything done is if you just get up and do it. Here's how to conquer those fears, get off your ass, and actually achieve those goals. - Getting off your ass and getting things done is not easy-nor will it ever be-but it doesn't have to be hard. If you have the right plan and attitude, you'll be a lot more likely to succeed. In fact, getting off your ass and doing something is incredibly easy and only requires a few steps: ✔️Find your goal. You don't even have to do anything-just sit and think about what you want to do. ✔️Research. The more research you do, the easier the task in front of you is going to be. Heck, you can do anything if all it takes is following directions. ✔️Set deadlines and stick to them: Setting deadlines is easy, just pick a date. Keeping yourself to them is a bit harder, but you can work a rewards system into it to keep you on track. ✔️Give yourself the time to work. At least 15 minutes a day. That's easy, right? 👀 ✔️Start. Seriously, all you have to do is start into it if you enjoy what you're doing, you'll keep it up. millionairementor

It’s time to get your sh*t together and start motivating yourself to actually achieve your goals. - Starting something new is hard. It can e...