ifs
ifs

ifs

yours
yours

yours

oed
oed

oed

faced
faced

faced

a girl
a girl

a girl

means
means

means

ims
ims

ims

Funny and Sad
Funny and Sad

Funny and Sad

Waiting...
Waiting...

Waiting...

Thought
Thought

Thought

🔥 | Latest

Fake, Family, and Hello: Aleli Miranda @tigerleli Never underestimate what a university student would do to get out of an eXam lmao ROGERS ? 20:19 92%-eoki ROGERS ? 20:26 @ 92%- .al. ROGERS 令 7 20:34 90%- 3 Messages Feb.13 Test Feb.13 Test Zacharey Watson Kaitlyn Wiens Good evening everyone, I have some troubling n. Andrew Woolford To: Andrew Cc: Georgia&54 more Manzah-Kyentoh Yankey Fontanne Yip Andrew Woolford 20:20 Details Prairie Skye Young-Brown Zainab Yusuf To: Andrew Ce Georgia&54moreDetails Please note that a fake gmail address was created using my name to try to pul off this hoax. Again, I repeat, the test will wake place tomorrow. Hello everyone. Feb.13 Test Today 3t 2018 Someone is impersonating me trying to delay the test. The test will happen tomorrow. Anyone found to be impersonating a professor to put off a test can expect a very strong response from the Best, (The real) Andrew Woolford Good evening everyone, I have some troubling news about the test tomorrow. I have a family emergency right now meaning i wil not be able to attend class tomorrow. We will be forced to push the test back a dass. This will give everyone one more day to prepare. Sorry for the inconvenience. Sent from my iPhone Andrew Bost, Andrew Sent from my iPhone Andrew Woolford See More from Andrew Woolford Department of Sociology and Crieminology University of Mantoba Winnipeg. Manitoba Scientific studies show following @kalesalad instantly improves your life by 92.1%
Fake, Family, and Hello: Aleli Miranda
 @tigerleli
 Never underestimate what a university
 student would do to get out of an
 eXam lmao
 ROGERS ?
 20:19
 92%-eoki ROGERS ?
 20:26
 @ 92%-
 .al. ROGERS
 令
 7
 20:34
 90%-
 3 Messages
 Feb.13 Test
 Feb.13 Test
 Zacharey Watson Kaitlyn Wiens
 Good evening everyone, I have some troubling n.
 Andrew Woolford
 To: Andrew Cc: Georgia&54 more
 Manzah-Kyentoh Yankey Fontanne Yip
 Andrew Woolford
 20:20
 Details
 Prairie Skye Young-Brown
 Zainab Yusuf
 To: Andrew Ce Georgia&54moreDetails
 Please note that a fake gmail address was
 created using my name to try to pul off this hoax.
 Again, I repeat, the test will wake place tomorrow.
 Hello everyone.
 Feb.13 Test
 Today 3t 2018
 Someone is impersonating me trying to delay the
 test. The test will happen tomorrow. Anyone
 found to be impersonating a professor to put off
 a test can expect a very strong response from the
 Best,
 (The real) Andrew Woolford
 Good evening everyone, I have some troubling news
 about the test tomorrow. I have a family emergency
 right now meaning i wil not be able to attend class
 tomorrow. We will be forced to push the test back a
 dass. This will give everyone one more day to prepare.
 Sorry for the inconvenience.
 Sent from my iPhone
 Andrew
 Bost,
 Andrew
 Sent from my iPhone
 Andrew Woolford
 See More from Andrew
 Woolford
 Department of Sociology and Crieminology
 University of Mantoba
 Winnipeg. Manitoba
Scientific studies show following @kalesalad instantly improves your life by 92.1%

Scientific studies show following @kalesalad instantly improves your life by 92.1%

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

America, Beautiful, and Blood Moon: SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East and eastern Russia), Australia, or New Zealand, you might be in for a lunar treat Jan 31st! But before we tell you how early you might have to wake up to see this, @science.sam explains what a Super Blue Blood Moon is below: . A SuperBlueBloodMoon is the combination of 3 different lunar events that RARELY coincide. . A SUPER moon is when a full moon occurs when the moon is at the closest point in its elliptical orbit to the Earth, called the perigee. Though it’s hard to distinguish with the naked eye, the moon appears about 14% brighter than usual. . A BLUE moon refers to the 2nd full moon in a month, and doesn’t really have anything to do with colour. While the phrase, “once in a blue moon” is used to describe something that’s rare, blue moons actually occur about once every 2.7 years (there will be another blue moon in March, but it won’t be fully eclipsed)! . A BLOOD moon happens when the moon is in full eclipse - meaning that the Earth is blocking direct light from the sun from getting to the moon. Because of the lack of direct sunshine on the moon, the only light hitting it is refracted through the earth’s shadow, giving it the reddish look we also see at sunset. Due to the tilt of the moon’s orbit, not every full moon results in a total eclipse, though there are 2-5 lunar eclipses a year (though not always where you can see em). . The exciting thing about the SuperBlueBloodMoon is that all 3 of these things are happening at once! South America, Asia, and Australia got treated to this back in 1982, and the last time North America experienced this phenomenon was 1866. . The eclipse (peak awesomeness) will happen at 1:30pm UTC, meaning those in Asia + Oceania will be able to see it in the evening of Jan 31st, and those in western North America before dawn. . Regardless of rarity, it’ll be a gorgeous opportunity to gaze up, and even more beautiful if viewed through binoculars (a lunar eclipse is less dangerous to your eyes than a solar eclipse). . Tag a buddy you want to watch this with! . (image credit: @NASA)
America, Beautiful, and Blood Moon: SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East and eastern Russia), Australia, or New Zealand, you might be in for a lunar treat Jan 31st! But before we tell you how early you might have to wake up to see this, @science.sam explains what a Super Blue Blood Moon is below: . A SuperBlueBloodMoon is the combination of 3 different lunar events that RARELY coincide. . A SUPER moon is when a full moon occurs when the moon is at the closest point in its elliptical orbit to the Earth, called the perigee. Though it’s hard to distinguish with the naked eye, the moon appears about 14% brighter than usual. . A BLUE moon refers to the 2nd full moon in a month, and doesn’t really have anything to do with colour. While the phrase, “once in a blue moon” is used to describe something that’s rare, blue moons actually occur about once every 2.7 years (there will be another blue moon in March, but it won’t be fully eclipsed)! . A BLOOD moon happens when the moon is in full eclipse - meaning that the Earth is blocking direct light from the sun from getting to the moon. Because of the lack of direct sunshine on the moon, the only light hitting it is refracted through the earth’s shadow, giving it the reddish look we also see at sunset. Due to the tilt of the moon’s orbit, not every full moon results in a total eclipse, though there are 2-5 lunar eclipses a year (though not always where you can see em). . The exciting thing about the SuperBlueBloodMoon is that all 3 of these things are happening at once! South America, Asia, and Australia got treated to this back in 1982, and the last time North America experienced this phenomenon was 1866. . The eclipse (peak awesomeness) will happen at 1:30pm UTC, meaning those in Asia + Oceania will be able to see it in the evening of Jan 31st, and those in western North America before dawn. . Regardless of rarity, it’ll be a gorgeous opportunity to gaze up, and even more beautiful if viewed through binoculars (a lunar eclipse is less dangerous to your eyes than a solar eclipse). . Tag a buddy you want to watch this with! . (image credit: @NASA)

SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East...

Chicago, Children, and Family: Ballerific Woman: Michelle Obama, From The South Side Of Chicago To The White House @balleralert Read More: www.balleralert.com Ballerific Woman: Michelle Obama, From The South Side Of Chicago To The White House -blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ In a perfect world, men and women would receive equal pay. African American women would be presented the same opportunities as their white counterparts. Rejection would be based on qualifications rather than race. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Unfortunately, this world is far from perfect, however, there are people, more specifically women, who have dedicated their time, money and education to make a positive change. They’ve used their experiences and their encounters with injustices to fight and-or create more opportunities for their children and their children’s children, in an effort to make the world a better place. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ They've put our pain and problems on their backs and created space for change, new opportunities for our brothers and sisters to excel and succeed in a world that is designed against us. This is BlackExcellence. These are BallerificWomen. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ One of those special individuals is MichelleObama, from the South Side of Chicago to the White House. Our forever First Lady is the true definition of a 'Phenomenal Woman.' She walked into our lives in 2008 and has shown the world the true meaning of love, dedication, family, education, and healthy living. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ No matter the occasion or event, our First Lady was sure to take over with her elegant and classy sense of style. She was featured in Essence Magazine as one of the ‘World’s Most Inspiring Women’ and appeared on the cover of Vogue and made the Vanity Fair best-dressed list two years in a row. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As our First Lady of the United States, she was not afraid to address the issues at stake. Every speech that she has given has left us with the hope of progress. In her final speech as our FLOTUS, she stated, “Being your First Lady has been the greatest honor of my life and hope I’ve made you proud”..........to read the rest log on to BallerAlert.com (clickable link on profile)
Chicago, Children, and Family: Ballerific Woman: Michelle Obama,
 From The South Side Of Chicago To
 The White House
 @balleralert
 Read More: www.balleralert.com
Ballerific Woman: Michelle Obama, From The South Side Of Chicago To The White House -blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ In a perfect world, men and women would receive equal pay. African American women would be presented the same opportunities as their white counterparts. Rejection would be based on qualifications rather than race. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Unfortunately, this world is far from perfect, however, there are people, more specifically women, who have dedicated their time, money and education to make a positive change. They’ve used their experiences and their encounters with injustices to fight and-or create more opportunities for their children and their children’s children, in an effort to make the world a better place. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ They've put our pain and problems on their backs and created space for change, new opportunities for our brothers and sisters to excel and succeed in a world that is designed against us. This is BlackExcellence. These are BallerificWomen. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ One of those special individuals is MichelleObama, from the South Side of Chicago to the White House. Our forever First Lady is the true definition of a 'Phenomenal Woman.' She walked into our lives in 2008 and has shown the world the true meaning of love, dedication, family, education, and healthy living. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ No matter the occasion or event, our First Lady was sure to take over with her elegant and classy sense of style. She was featured in Essence Magazine as one of the ‘World’s Most Inspiring Women’ and appeared on the cover of Vogue and made the Vanity Fair best-dressed list two years in a row. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As our First Lady of the United States, she was not afraid to address the issues at stake. Every speech that she has given has left us with the hope of progress. In her final speech as our FLOTUS, she stated, “Being your First Lady has been the greatest honor of my life and hope I’ve made you proud”..........to read the rest log on to BallerAlert.com (clickable link on profile)

Ballerific Woman: Michelle Obama, From The South Side Of Chicago To The White House -blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ In a perfect worl...

Community, Lenny, and Lenny Kravitz: #BAGreekLove. Happy Founder's Day Alpha Kappa Alpha Sorority, Inc. @balleralert BAGreekLove: Happy Founder’s Day Alpha Kappa Alpha Sorority, Inc ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about your culture. It wasn’t until the 1830’s that African Americans were even able to receive higher education. That was just the beginning. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ At an HBCU there are many opportunities for students to learn the true meaning of brotherhood and sisterhood. From the marching bands and the dancers, and of course to the nine historically Black Greek Letter Organizations(BGLOs) also referred to as the “divine nine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ To continue to show our love and appreciation for HBCUs, we would like to highlight the “divine nine” at different HBCUs to showcase community involvement as well as the creative steps and strolls. If you would like to show what your organization is doing at your HBCU, please DM @peachkyss or email at peachkyss@balleralert.com ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The sorority was founded on January 15, 1908, at the historically black Howard University in Washington, D.C., by a group of sixteen students led by Ethel Hedgeman Lyle. Forming a sorority broke barriers for African-American women in areas where they had little power or authority, due to a lack of opportunities for minorities and women in the early 20th century. Alpha Kappa Alpha was incorporated on January 29, 1913. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Some well known Alpha Kappa Alpha’s feature PhyliciaRashad, LorettaDevine, RoxieRoker (mother of Lenny Kravitz), MonyettaShaw, ShamariDeVoe (R&B Group Blaque), and StarJones. Honorary members include AliciaKeys, MayaAngelou, GladysKnight, CorrettaScottKing, and more. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Founder’s Day!
Community, Lenny, and Lenny Kravitz:  #BAGreekLove. Happy Founder's Day
 Alpha Kappa Alpha Sorority, Inc.
 @balleralert
BAGreekLove: Happy Founder’s Day Alpha Kappa Alpha Sorority, Inc ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about your culture. It wasn’t until the 1830’s that African Americans were even able to receive higher education. That was just the beginning. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ At an HBCU there are many opportunities for students to learn the true meaning of brotherhood and sisterhood. From the marching bands and the dancers, and of course to the nine historically Black Greek Letter Organizations(BGLOs) also referred to as the “divine nine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ To continue to show our love and appreciation for HBCUs, we would like to highlight the “divine nine” at different HBCUs to showcase community involvement as well as the creative steps and strolls. If you would like to show what your organization is doing at your HBCU, please DM @peachkyss or email at peachkyss@balleralert.com ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The sorority was founded on January 15, 1908, at the historically black Howard University in Washington, D.C., by a group of sixteen students led by Ethel Hedgeman Lyle. Forming a sorority broke barriers for African-American women in areas where they had little power or authority, due to a lack of opportunities for minorities and women in the early 20th century. Alpha Kappa Alpha was incorporated on January 29, 1913. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Some well known Alpha Kappa Alpha’s feature PhyliciaRashad, LorettaDevine, RoxieRoker (mother of Lenny Kravitz), MonyettaShaw, ShamariDeVoe (R&B Group Blaque), and StarJones. Honorary members include AliciaKeys, MayaAngelou, GladysKnight, CorrettaScottKing, and more. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Founder’s Day!

BAGreekLove: Happy Founder’s Day Alpha Kappa Alpha Sorority, Inc ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about ...

Community, Love, and Memes: #BAGreekLove: Happy Founder's Day Delta Sigma Theta Sorority, Inc @balleralert BAGreekLove: Happy Founder’s Day Delta Sigma Theta (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about your culture. It wasn’t until the 1830’s that African Americans were even able to receive higher education. That was just the beginning. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ At an HBCU there are many opportunities for students to learn the true meaning of brotherhood and sisterhood. From the marching bands and the dancers, to the nine historically Black Greek Letter Organizations(BGLOs) also referred to as the “divine nine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ To continue to show our love and appreciation for HBCUs, we would like to highlight the “divine nine” at different HBCUs to showcase community involvement as well as the creative steps and strolls. If you would like to show what your organization is doing at your HBCU, please DM @peachkyss or email at peachkyss@balleralert.com ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Delta Sigma Theta was founded on January 13, 1913 by 22 collegiate women at Howard University. The ladies used their strength to promote academic excellence and assistance to those in need. In March of 1913, the Founders of Delta Sigma Theta Sorority, Inc. participated in the Women's Suffrage March in Washington, D.C. Delta Sigma Theta Sorority, Inc. was incorporated in 1930. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Some well known Delta Sigma Theta members are KeshiaKnightPulliam, MaraBrockAkil, KymWhitley, ShirleyChisholm, CicelyTyson, ArethaFranklin, NatalieCole, AngelaBassett, and so many more. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Founder’s Day!
Community, Love, and Memes:  #BAGreekLove: Happy Founder's Day
 Delta Sigma Theta Sorority, Inc
 @balleralert
BAGreekLove: Happy Founder’s Day Delta Sigma Theta (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about your culture. It wasn’t until the 1830’s that African Americans were even able to receive higher education. That was just the beginning. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ At an HBCU there are many opportunities for students to learn the true meaning of brotherhood and sisterhood. From the marching bands and the dancers, to the nine historically Black Greek Letter Organizations(BGLOs) also referred to as the “divine nine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ To continue to show our love and appreciation for HBCUs, we would like to highlight the “divine nine” at different HBCUs to showcase community involvement as well as the creative steps and strolls. If you would like to show what your organization is doing at your HBCU, please DM @peachkyss or email at peachkyss@balleralert.com ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Delta Sigma Theta was founded on January 13, 1913 by 22 collegiate women at Howard University. The ladies used their strength to promote academic excellence and assistance to those in need. In March of 1913, the Founders of Delta Sigma Theta Sorority, Inc. participated in the Women's Suffrage March in Washington, D.C. Delta Sigma Theta Sorority, Inc. was incorporated in 1930. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Some well known Delta Sigma Theta members are KeshiaKnightPulliam, MaraBrockAkil, KymWhitley, ShirleyChisholm, CicelyTyson, ArethaFranklin, NatalieCole, AngelaBassett, and so many more. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Founder’s Day!

BAGreekLove: Happy Founder’s Day Delta Sigma Theta (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about your c...

Bad, Comfortable, and Confidence: LEARN TO BE UNCOMFORTABLE Would you like to learn how to get comfortable with the uncomfortable? Read on!👇 ✔️Start. The first step is always the most uncomfortable. All you have to do is show up. The battle is half won if you just show up. I get it. It's uncomfortable to start something. ✔️Don't quit. You've decided to start. You're not seeing results. It's difficult. You want to quit. It's OK. Just keep pushing forward. You are not a P***y. ✔️Push yourself past your comfort zone. At some point, you are going to say to yourself, "I've never done this before" or "I don't know what I'm doing." We've all been there. Here's a trick: Don't say it out loud. Just pretend to be confident. Fake it till you make it. It's scary, but I promise you this: When it's over, you are going to say, "It wasn't as bad as I thought it was." Fear kills more dreams than failure ever will. ✔️Be around like-minded people. Create a support network. Talk about your experiences. The worse the experience it is to you, the better the story it is to everyone else. Soon, you will be seeking uncomfortable experiences to share with your friends. Be a good storyteller. ✔️Rinse. Repeat. There's an old Russian saying, povtorenie mat ucheniya, (I don’t even know Russian but I found the meaning on google haha) which means "repetition is the mother of learning." The more you perform the same activity, the more confident you become. Confidence is a tangible thing, it comes from practice and repetition. - uncomfortable comfortable success millionairementor
Bad, Comfortable, and Confidence: LEARN TO BE
 UNCOMFORTABLE
Would you like to learn how to get comfortable with the uncomfortable? Read on!👇 ✔️Start. The first step is always the most uncomfortable. All you have to do is show up. The battle is half won if you just show up. I get it. It's uncomfortable to start something. ✔️Don't quit. You've decided to start. You're not seeing results. It's difficult. You want to quit. It's OK. Just keep pushing forward. You are not a P***y. ✔️Push yourself past your comfort zone. At some point, you are going to say to yourself, "I've never done this before" or "I don't know what I'm doing." We've all been there. Here's a trick: Don't say it out loud. Just pretend to be confident. Fake it till you make it. It's scary, but I promise you this: When it's over, you are going to say, "It wasn't as bad as I thought it was." Fear kills more dreams than failure ever will. ✔️Be around like-minded people. Create a support network. Talk about your experiences. The worse the experience it is to you, the better the story it is to everyone else. Soon, you will be seeking uncomfortable experiences to share with your friends. Be a good storyteller. ✔️Rinse. Repeat. There's an old Russian saying, povtorenie mat ucheniya, (I don’t even know Russian but I found the meaning on google haha) which means "repetition is the mother of learning." The more you perform the same activity, the more confident you become. Confidence is a tangible thing, it comes from practice and repetition. - uncomfortable comfortable success millionairementor

Would you like to learn how to get comfortable with the uncomfortable? Read on!👇 ✔️Start. The first step is always the most uncomfortable. A...

Community, Fraternity, and Love: #BAGreekLove. Happy Founder's Day Kappa Alpha Psi Fraternity, Inc. @balleralert BAGreekLove: Happy Founder’s Day Kappa Alpha Psi Fraternity, Inc. (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending a HBCU to learn more about your culture. It wasn’t until the 1830’s that African Americans were even able to receive higher education. That was just the beginning. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ At an HBCU there are many opportunities for students to learn the true meaning of brotherhood and sisterhood. From the marching bands and the dancers, and of course to the nine historically Black Greek Letter Organizations(BGLOs) also referred to as the “divine nine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ To continue to show our love and appreciation for HBCUs, we would like to highlight the “divine nine” at different HBCUs to showcase community involvement as well as the creative steps and strolls. If you would like to show what your organization is doing at your HBCU, please DM @peachkyss or email at peachkyss@balleralert.com ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Kappa Alpha Psi Fraternity, Inc. was founded as Kappa Alpha Nu on January 5, 1911 by Founders Elder Watson Diggs; John Milton Lee; Byron Kenneth Armstrong; Guy Levis Grant; Ezra Dee Alexander; Henry Tourner Asher; Marcus Peter Blakemore; Paul Waymond Caine; Edward Giles Irvin and George Wesley Edmonds. The early vision of the Kappas was to serve as a social group dedicated to Black students on Indiana’s campus and to promote personal excellence. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Kappas have become known for their elaborate cane-assisted “stepping” routines and their “shimmy,” but the group prides itself for its service work beyond step show performances. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Founder’s Day frats, and of course our faves ColinKaepernick, CedrictheEntertainer.
Community, Fraternity, and Love:  #BAGreekLove. Happy Founder's Day
 Kappa Alpha Psi Fraternity, Inc.
 @balleralert
BAGreekLove: Happy Founder’s Day Kappa Alpha Psi Fraternity, Inc. (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending a HBCU to learn more about your culture. It wasn’t until the 1830’s that African Americans were even able to receive higher education. That was just the beginning. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ At an HBCU there are many opportunities for students to learn the true meaning of brotherhood and sisterhood. From the marching bands and the dancers, and of course to the nine historically Black Greek Letter Organizations(BGLOs) also referred to as the “divine nine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ To continue to show our love and appreciation for HBCUs, we would like to highlight the “divine nine” at different HBCUs to showcase community involvement as well as the creative steps and strolls. If you would like to show what your organization is doing at your HBCU, please DM @peachkyss or email at peachkyss@balleralert.com ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Kappa Alpha Psi Fraternity, Inc. was founded as Kappa Alpha Nu on January 5, 1911 by Founders Elder Watson Diggs; John Milton Lee; Byron Kenneth Armstrong; Guy Levis Grant; Ezra Dee Alexander; Henry Tourner Asher; Marcus Peter Blakemore; Paul Waymond Caine; Edward Giles Irvin and George Wesley Edmonds. The early vision of the Kappas was to serve as a social group dedicated to Black students on Indiana’s campus and to promote personal excellence. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Kappas have become known for their elaborate cane-assisted “stepping” routines and their “shimmy,” but the group prides itself for its service work beyond step show performances. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Founder’s Day frats, and of course our faves ColinKaepernick, CedrictheEntertainer.

BAGreekLove: Happy Founder’s Day Kappa Alpha Psi Fraternity, Inc. (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending a HBCU to learn mor...

Bless Up, Chipotle, and Dating: u/TheMorganiser 4d She held a rubber duckie in her mouth to keep herself calm as I gave her a shower @DrSmashlove See bruv a big part of being a grown man is reading code. Ladies don’t text in English. Ladies text in code. If u ain got the Cap’n Crunch Decoder Ring ®️ u doomed to a lifetime of being lost in the sauce. Smash is here to help u decode 🤗. Now, on the pages of this account, I have detailed the true meaning behind the “GOOD NIGHT” text sent before the hour of 9 pm. As I’ve stated - nobody going to schleep at 8:02 pm. What she doing is saying: “BISH U ON NOTICE.” But many steps have to occur on the way to GOOD NIGHT. By then u done pissed her off to the point where she real, real tight with u. So what are the warning signs. One of my favorites is the following morning text: “Ok! Well, hope you have a good day 😌.” MEN ... BE CAUTIOUS 😂. Nothing about this text mean what it say. Girls don’t want u to have a good day. Quite the opposite. They wanna text u ALLLL DAY and get as many details as possible about ya a$$. How was lunch? Oh good. How’s work? How’s the gym? How’s dinner at Chipotle after the gym? Did u get queso? OMG THE QUESO MAKES THE BURRITO BOWL SO GOOD LOL LIKE GUAC *AND* QUESO I’VE DIED AND GONE TO HEAVEN HAHA WYD. Nah. Hell nah. “Hope you have a good day” is code for “well now. I see you’re too busy to reply to my text at 9:02 am by 9:01 am like a good man should. Because you’re not a good man. In fact you’re awful. Literally why are we talking? GOOD 👏 PP 👏 WAS 👏 ENUF 👏 FOR 👏 ME 👏 WHEN 👏 I 👏 WAS 👏 22 👏 BUT 👏 I’M 👏 27 👏 NOW 👏 I’M 👏 A 👏 NEW 👏 KATELYN 👏 AND 👏 THIS 👏 KATELYN 👏 WON’T 👏 ACCEPT 👏 ‘Read 9:02 AM’. Question: why are you even dating? Mmmmwhy do you even think you’re fit to date? 🤔 YOU’RE STILL A HURT LITTLE BOY. YOU’RE NOT A GROWN MAN. GROWN MET REPLY TO A TEXT AT 9:02 am BY 9:01 am. WHERE IS A MAN WHO WILL ANTICIPATE MY FEELINGS AND TEXT ME WHAT I’M ALREADY THINKING WHILE I’M STILL COMPOSING MY THOUGHTS BUT HE SEES THREE DOTS AND CAN ALREADY READ MY MIND? WHERE, GOD? Ok. Forget it. Back to Bumble. Maybe Matt2983 will do BETTER. Hope you have a good day 😌.” BLESS UP 😍😂😂😂
Bless Up, Chipotle, and Dating: u/TheMorganiser 4d
 She held a rubber duckie in her mouth to
 keep herself calm as I gave her a shower
 @DrSmashlove
See bruv a big part of being a grown man is reading code. Ladies don’t text in English. Ladies text in code. If u ain got the Cap’n Crunch Decoder Ring ®️ u doomed to a lifetime of being lost in the sauce. Smash is here to help u decode 🤗. Now, on the pages of this account, I have detailed the true meaning behind the “GOOD NIGHT” text sent before the hour of 9 pm. As I’ve stated - nobody going to schleep at 8:02 pm. What she doing is saying: “BISH U ON NOTICE.” But many steps have to occur on the way to GOOD NIGHT. By then u done pissed her off to the point where she real, real tight with u. So what are the warning signs. One of my favorites is the following morning text: “Ok! Well, hope you have a good day 😌.” MEN ... BE CAUTIOUS 😂. Nothing about this text mean what it say. Girls don’t want u to have a good day. Quite the opposite. They wanna text u ALLLL DAY and get as many details as possible about ya a$$. How was lunch? Oh good. How’s work? How’s the gym? How’s dinner at Chipotle after the gym? Did u get queso? OMG THE QUESO MAKES THE BURRITO BOWL SO GOOD LOL LIKE GUAC *AND* QUESO I’VE DIED AND GONE TO HEAVEN HAHA WYD. Nah. Hell nah. “Hope you have a good day” is code for “well now. I see you’re too busy to reply to my text at 9:02 am by 9:01 am like a good man should. Because you’re not a good man. In fact you’re awful. Literally why are we talking? GOOD 👏 PP 👏 WAS 👏 ENUF 👏 FOR 👏 ME 👏 WHEN 👏 I 👏 WAS 👏 22 👏 BUT 👏 I’M 👏 27 👏 NOW 👏 I’M 👏 A 👏 NEW 👏 KATELYN 👏 AND 👏 THIS 👏 KATELYN 👏 WON’T 👏 ACCEPT 👏 ‘Read 9:02 AM’. Question: why are you even dating? Mmmmwhy do you even think you’re fit to date? 🤔 YOU’RE STILL A HURT LITTLE BOY. YOU’RE NOT A GROWN MAN. GROWN MET REPLY TO A TEXT AT 9:02 am BY 9:01 am. WHERE IS A MAN WHO WILL ANTICIPATE MY FEELINGS AND TEXT ME WHAT I’M ALREADY THINKING WHILE I’M STILL COMPOSING MY THOUGHTS BUT HE SEES THREE DOTS AND CAN ALREADY READ MY MIND? WHERE, GOD? Ok. Forget it. Back to Bumble. Maybe Matt2983 will do BETTER. Hope you have a good day 😌.” BLESS UP 😍😂😂😂

See bruv a big part of being a grown man is reading code. Ladies don’t text in English. Ladies text in code. If u ain got the Cap’n Crunch D...