Meaning



                

                

                

            

        
    







            

            
            

                

                    
                

                

                    

                        


	

	
    
        

            

                
                    
                    
                    
                    

    

        ifs
        

            
            ifs
        

    

    

         
ifs

    



                
                    
                    
                    
                    

    

        yours
        

            
            yours
        

    

    

         
yours

    



                
                    
                    
                    
                    

    

        oed
        

            
            oed
        

    

    

         
oed

    



                
                    
                    
                    
                    

    

        faced
        

            
            faced
        

    

    

         
faced

    



                
                    
                    
                    
                    

    

        a girl
        

            
            a girl
        

    

    

         
a girl

    



                
                    
                    
                    
                    

    

        means
        

            
            means
        

    

    

         
means

    



                
                    
                    
                    
                    

    

        ims
        

            
            ims
        

    

    

         
ims

    



                
                    
                    
                    
                    

    

        Funny and Sad
        

            
            Funny and Sad
        

    

    

         
Funny and Sad

    



                
                    
                    
                    
                    

    

        Waiting...
        

            
            Waiting...
        

    

    

         
Waiting...

    



                
                    
                    
                    
                    

    

        Thought
        

            
            Thought
        

    

    

         
Thought

    



                
            

        

    
    

        🔥 | Latest
    

    
    

        

        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                




    Africa, cnn.com, and Memes: White South African Woman Becomes First
 To Be Jailed For Hate Speech After Video Of
 Her Racist Rant Goes Viral; Sentenced To
 Three Years
 @balleralert
White South African Woman Becomes First To Be Jailed For Hate Speech After Video Of Her Racist Rant Goes Viral; Sentenced To Three Years – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ While racist, hate speech should never be tolerated, it is strictly prohibited in South Africa, as it is specifically excluded from the protection of free speech in the Constitution. In fact, according to the NY Times, back in 2016, the country released a draft law that would criminalize racism, meaning hate speech cases would go to criminal courts instead of civil and would be punishable by up to 10 years in prison. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Since then, the nation has moved to implement the new rules and subsequently make an example of a white South African woman. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ According to CNN, Vicki Momberg was found guilty in November for crimen injuria, better known as the willful injuring of someone’s dignity in her racist verbal attack on a black police officer. The incident was caught on camera and quickly went viral. Since then, Momberg has been prosecuted and sentenced to three years in prison with one year suspended sentence, as she becomes the first South African to be jailed for the offense. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ “We’ve had crimen injuria (cases before), but they have always been coupled by other charges. This is the first for a prison sentence for crimen injuria on its own,” a spokesperson said of the sentencing. “We are pleased with the sentence. This sends a clear message to those who undermine other people’s rights.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ In the incident that led to the sentencing, Momberg was caught on video hurling racial slurs at South African police officers after they stopped to help her after her car was broken into in Johannesburg. According to reports, she repeatedly used words that were used to insult black people during the apartheid. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Now, Momberg will have two years behind bars to think about her actions.
    

        
        
        
        
        
        
        
        
    

    

        

            
            

                
                
                    Africa, cnn.com, and Memes: White South African Woman Becomes First
 To Be Jailed For Hate Speech After Video Of
 Her Racist Rant Goes Viral; Sentenced To
 Three Years
 @balleralert
White South African Woman Becomes First To Be Jailed For Hate Speech After Video Of Her Racist Rant Goes Viral; Sentenced To Three Years – blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ While racist, hate speech should never be tolerated, it is strictly prohibited in South Africa, as it is specifically excluded from the protection of free speech in the Constitution. In fact, according to the NY Times, back in 2016, the country released a draft law that would criminalize racism, meaning hate speech cases would go to criminal courts instead of civil and would be punishable by up to 10 years in prison. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Since then, the nation has moved to implement the new rules and subsequently make an example of a white South African woman. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ According to CNN, Vicki Momberg was found guilty in November for crimen injuria, better known as the willful injuring of someone’s dignity in her racist verbal attack on a black police officer. The incident was caught on camera and quickly went viral. Since then, Momberg has been prosecuted and sentenced to three years in prison with one year suspended sentence, as she becomes the first South African to be jailed for the offense. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ “We’ve had crimen injuria (cases before), but they have always been coupled by other charges. This is the first for a prison sentence for crimen injuria on its own,” a spokesperson said of the sentencing. “We are pleased with the sentence. This sends a clear message to those who undermine other people’s rights.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ In the incident that led to the sentencing, Momberg was caught on video hurling racial slurs at South African police officers after they stopped to help her after her car was broken into in Johannesburg. According to reports, she repeatedly used words that were used to insult black people during the apartheid. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Now, Momberg will have two years behind bars to think about her actions.
                    
                    

                    
                
            

            
            
White South African Woman Becomes First To Be Jailed For Hate Speech After Video Of Her Racist Rant Goes Viral; Sentenced To Three Years – b...

            
            
        

    



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                




    Lawyer, Memes, and Money: Judge Rules In Favor Of Jill Scott; She Will
 Not Be Forced To Pay Mike Dobson's Legal
 Fees Thanks To Their Prenup
 @balleralert
Judge Rules In Favor Of Jill Scott; She Will Not Be Forced To Pay Mike Dobson’s Legal Fees Thanks To Their Prenup - blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ As the divorce battle between Jill Scott and estranged husband Mike Dobson continues, a new development in the case has resulted in a major win for Scott. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On Monday, a judge ruled in favor of Scott, and honored the former couple’s prenup, where both parties “agreed not to seek alimony, maintenance or spousal support,” @officialbossip reports. Now, Scott will not be responsible for Dobson’s divorce legal fees as it is a form of support. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ In fact, in Monday’s hearing, Scott’s lawyer said she provided Dobson with an additional $20,000 before she filed for divorce. But, Dobson said he had to spend the money on “family expenses,” so he never touched any of it. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ In the end, the judge denied Dobson’s motion for the monetary release, however, he did so without prejudice, meaning Dobson will be able to file for other options as the case continues.
    

        
        
        
        
        
        
        
        
    

    

        

            
            

                
                
                    Lawyer, Memes, and Money: Judge Rules In Favor Of Jill Scott; She Will
 Not Be Forced To Pay Mike Dobson's Legal
 Fees Thanks To Their Prenup
 @balleralert
Judge Rules In Favor Of Jill Scott; She Will Not Be Forced To Pay Mike Dobson’s Legal Fees Thanks To Their Prenup - blogged by @MsJennyb ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ As the divorce battle between Jill Scott and estranged husband Mike Dobson continues, a new development in the case has resulted in a major win for Scott. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ On Monday, a judge ruled in favor of Scott, and honored the former couple’s prenup, where both parties “agreed not to seek alimony, maintenance or spousal support,” @officialbossip reports. Now, Scott will not be responsible for Dobson’s divorce legal fees as it is a form of support. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ In fact, in Monday’s hearing, Scott’s lawyer said she provided Dobson with an additional $20,000 before she filed for divorce. But, Dobson said he had to spend the money on “family expenses,” so he never touched any of it. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ In the end, the judge denied Dobson’s motion for the monetary release, however, he did so without prejudice, meaning Dobson will be able to file for other options as the case continues.
                    
                
            

            
            
Judge Rules In Favor Of Jill Scott; She Will Not Be Forced To Pay Mike Dobson’s Legal Fees Thanks To Their Prenup - blogged by @MsJennyb ⠀⠀⠀...

            
            
        

    



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                




    Head, Life, and Memes: 2
 a b
 abid
 MILLIOHAIRE MENTOR
 HOWEVER DIFFICULT LIFE MAY SEEM
 THERE'SALWAYS SOMETHING YOU CAN
 DO AND SUCCEED AT. IT MATTERS THAT
 YOU DON'T JUST GIVE UP"
 Stephen Hawking
I’m writing this quick post to send strength and faith out to my followers. I hope that wherever this finds you it gives you light and a reminds you to stay positive, stay strong, and keep your head up👇 ✔️Everything in life is temporary. Every time it rains, it stops raining. Every time you get hurt, you heal. Your mind might tell you that this will last forever. It won’t. Nothing lasts forever. After darkness there is always light and this too shall pass. ✔️You are strong enough to rise above this. Life is tough, but you are tougher. No matter how much it hurts, hold your head up and keep going. You were given this challenge because you are strong enough to handle it. Use each setback, each disappointment as a cue to push on ahead with more determination than ever before. ✔️Where you are right now is a necessary step. You are not what you have done, you are what you have overcome. Your struggles are part of your path. No pain comes without a purpose. Pain is part of growing and living a stronger, more meaningful life. ✔️You can’t have happiness without sadness. Its important to understand that you cant know real joy without real sadness. Life’s ups require life’s downs. When you are able to let go and be at peace with the reality of these ups and downs is when you are able to find more meaning from any challenge. - R.I.P Stephen Hawking 🙏 - rip nevergiveup succeed millionairementor
    

        
        
        
        
        
        
        
        
    

    

        

            
            

                
                
                    Head, Life, and Memes: 2
 a b
 abid
 MILLIOHAIRE MENTOR
 HOWEVER DIFFICULT LIFE MAY SEEM
 THERE'SALWAYS SOMETHING YOU CAN
 DO AND SUCCEED AT. IT MATTERS THAT
 YOU DON'T JUST GIVE UP"
 Stephen Hawking
I’m writing this quick post to send strength and faith out to my followers. I hope that wherever this finds you it gives you light and a reminds you to stay positive, stay strong, and keep your head up👇 ✔️Everything in life is temporary. Every time it rains, it stops raining. Every time you get hurt, you heal. Your mind might tell you that this will last forever. It won’t. Nothing lasts forever. After darkness there is always light and this too shall pass. ✔️You are strong enough to rise above this. Life is tough, but you are tougher. No matter how much it hurts, hold your head up and keep going. You were given this challenge because you are strong enough to handle it. Use each setback, each disappointment as a cue to push on ahead with more determination than ever before. ✔️Where you are right now is a necessary step. You are not what you have done, you are what you have overcome. Your struggles are part of your path. No pain comes without a purpose. Pain is part of growing and living a stronger, more meaningful life. ✔️You can’t have happiness without sadness. Its important to understand that you cant know real joy without real sadness. Life’s ups require life’s downs. When you are able to let go and be at peace with the reality of these ups and downs is when you are able to find more meaning from any challenge. - R.I.P Stephen Hawking 🙏 - rip nevergiveup succeed millionairementor
                    
                
            

            
            
I’m writing this quick post to send strength and faith out to my followers. I hope that wherever this finds you it gives you light and a rem...

            
            
        

    



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                




    Fake, Family, and Hello: Aleli Miranda
 @tigerleli
 Never underestimate what a university
 student would do to get out of an
 eXam lmao
 ROGERS ?
 20:19
 92%-eoki ROGERS ?
 20:26
 @ 92%-
 .al. ROGERS
 令
 7
 20:34
 90%-
 3 Messages
 Feb.13 Test
 Feb.13 Test
 Zacharey Watson Kaitlyn Wiens
 Good evening everyone, I have some troubling n.
 Andrew Woolford
 To: Andrew Cc: Georgia&54 more
 Manzah-Kyentoh Yankey Fontanne Yip
 Andrew Woolford
 20:20
 Details
 Prairie Skye Young-Brown
 Zainab Yusuf
 To: Andrew Ce Georgia&54moreDetails
 Please note that a fake gmail address was
 created using my name to try to pul off this hoax.
 Again, I repeat, the test will wake place tomorrow.
 Hello everyone.
 Feb.13 Test
 Today 3t 2018
 Someone is impersonating me trying to delay the
 test. The test will happen tomorrow. Anyone
 found to be impersonating a professor to put off
 a test can expect a very strong response from the
 Best,
 (The real) Andrew Woolford
 Good evening everyone, I have some troubling news
 about the test tomorrow. I have a family emergency
 right now meaning i wil not be able to attend class
 tomorrow. We will be forced to push the test back a
 dass. This will give everyone one more day to prepare.
 Sorry for the inconvenience.
 Sent from my iPhone
 Andrew
 Bost,
 Andrew
 Sent from my iPhone
 Andrew Woolford
 See More from Andrew
 Woolford
 Department of Sociology and Crieminology
 University of Mantoba
 Winnipeg. Manitoba
Scientific studies show following @kalesalad instantly improves your life by 92.1%
    

        
        
        
        
        
        
        
        
    

    

        

            
            

                
                
                    Fake, Family, and Hello: Aleli Miranda
 @tigerleli
 Never underestimate what a university
 student would do to get out of an
 eXam lmao
 ROGERS ?
 20:19
 92%-eoki ROGERS ?
 20:26
 @ 92%-
 .al. ROGERS
 令
 7
 20:34
 90%-
 3 Messages
 Feb.13 Test
 Feb.13 Test
 Zacharey Watson Kaitlyn Wiens
 Good evening everyone, I have some troubling n.
 Andrew Woolford
 To: Andrew Cc: Georgia&54 more
 Manzah-Kyentoh Yankey Fontanne Yip
 Andrew Woolford
 20:20
 Details
 Prairie Skye Young-Brown
 Zainab Yusuf
 To: Andrew Ce Georgia&54moreDetails
 Please note that a fake gmail address was
 created using my name to try to pul off this hoax.
 Again, I repeat, the test will wake place tomorrow.
 Hello everyone.
 Feb.13 Test
 Today 3t 2018
 Someone is impersonating me trying to delay the
 test. The test will happen tomorrow. Anyone
 found to be impersonating a professor to put off
 a test can expect a very strong response from the
 Best,
 (The real) Andrew Woolford
 Good evening everyone, I have some troubling news
 about the test tomorrow. I have a family emergency
 right now meaning i wil not be able to attend class
 tomorrow. We will be forced to push the test back a
 dass. This will give everyone one more day to prepare.
 Sorry for the inconvenience.
 Sent from my iPhone
 Andrew
 Bost,
 Andrew
 Sent from my iPhone
 Andrew Woolford
 See More from Andrew
 Woolford
 Department of Sociology and Crieminology
 University of Mantoba
 Winnipeg. Manitoba
Scientific studies show following @kalesalad instantly improves your life by 92.1%
                    
                
            

            
            
Scientific studies show following @kalesalad instantly improves your life by 92.1%

            
            
        

    



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                




    Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
    

        
        
        
        
        
        
        
        
    

    

        

            
            

                
                
                    Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
                    
                
            

            
            
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

            
            
        

    



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                




    America, Beautiful, and Blood Moon: SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East and eastern Russia), Australia, or New Zealand, you might be in for a lunar treat Jan 31st! But before we tell you how early you might have to wake up to see this, @science.sam explains what a Super Blue Blood Moon is below: . A SuperBlueBloodMoon is the combination of 3 different lunar events that RARELY coincide. . A SUPER moon is when a full moon occurs when the moon is at the closest point in its elliptical orbit to the Earth, called the perigee. Though it’s hard to distinguish with the naked eye, the moon appears about 14% brighter than usual. . A BLUE moon refers to the 2nd full moon in a month, and doesn’t really have anything to do with colour. While the phrase, “once in a blue moon” is used to describe something that’s rare, blue moons actually occur about once every 2.7 years (there will be another blue moon in March, but it won’t be fully eclipsed)! . A BLOOD moon happens when the moon is in full eclipse - meaning that the Earth is blocking direct light from the sun from getting to the moon. Because of the lack of direct sunshine on the moon, the only light hitting it is refracted through the earth’s shadow, giving it the reddish look we also see at sunset. Due to the tilt of the moon’s orbit, not every full moon results in a total eclipse, though there are 2-5 lunar eclipses a year (though not always where you can see em). . The exciting thing about the SuperBlueBloodMoon is that all 3 of these things are happening at once! South America, Asia, and Australia got treated to this back in 1982, and the last time North America experienced this phenomenon was 1866. . The eclipse (peak awesomeness) will happen at 1:30pm UTC, meaning those in Asia + Oceania will be able to see it in the evening of Jan 31st, and those in western North America before dawn. . Regardless of rarity, it’ll be a gorgeous opportunity to gaze up, and even more beautiful if viewed through binoculars (a lunar eclipse is less dangerous to your eyes than a solar eclipse). . Tag a buddy you want to watch this with! . (image credit: @NASA)
    

        
        
        
        
        
        
        
        
    

    

        

            
            

                
                
                    America, Beautiful, and Blood Moon: SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East and eastern Russia), Australia, or New Zealand, you might be in for a lunar treat Jan 31st! But before we tell you how early you might have to wake up to see this, @science.sam explains what a Super Blue Blood Moon is below: . A SuperBlueBloodMoon is the combination of 3 different lunar events that RARELY coincide. . A SUPER moon is when a full moon occurs when the moon is at the closest point in its elliptical orbit to the Earth, called the perigee. Though it’s hard to distinguish with the naked eye, the moon appears about 14% brighter than usual. . A BLUE moon refers to the 2nd full moon in a month, and doesn’t really have anything to do with colour. While the phrase, “once in a blue moon” is used to describe something that’s rare, blue moons actually occur about once every 2.7 years (there will be another blue moon in March, but it won’t be fully eclipsed)! . A BLOOD moon happens when the moon is in full eclipse - meaning that the Earth is blocking direct light from the sun from getting to the moon. Because of the lack of direct sunshine on the moon, the only light hitting it is refracted through the earth’s shadow, giving it the reddish look we also see at sunset. Due to the tilt of the moon’s orbit, not every full moon results in a total eclipse, though there are 2-5 lunar eclipses a year (though not always where you can see em). . The exciting thing about the SuperBlueBloodMoon is that all 3 of these things are happening at once! South America, Asia, and Australia got treated to this back in 1982, and the last time North America experienced this phenomenon was 1866. . The eclipse (peak awesomeness) will happen at 1:30pm UTC, meaning those in Asia + Oceania will be able to see it in the evening of Jan 31st, and those in western North America before dawn. . Regardless of rarity, it’ll be a gorgeous opportunity to gaze up, and even more beautiful if viewed through binoculars (a lunar eclipse is less dangerous to your eyes than a solar eclipse). . Tag a buddy you want to watch this with! . (image credit: @NASA)
                    
                
            

            
            
SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East...

            
            
        

    



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                




    Chicago, Children, and Family: Ballerific Woman: Michelle Obama,
 From The South Side Of Chicago To
 The White House
 @balleralert
 Read More: www.balleralert.com
Ballerific Woman: Michelle Obama, From The South Side Of Chicago To The White House -blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ In a perfect world, men and women would receive equal pay. African American women would be presented the same opportunities as their white counterparts. Rejection would be based on qualifications rather than race. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Unfortunately, this world is far from perfect, however, there are people, more specifically women, who have dedicated their time, money and education to make a positive change. They’ve used their experiences and their encounters with injustices to fight and-or create more opportunities for their children and their children’s children, in an effort to make the world a better place. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ They've put our pain and problems on their backs and created space for change, new opportunities for our brothers and sisters to excel and succeed in a world that is designed against us. This is BlackExcellence. These are BallerificWomen. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ One of those special individuals is MichelleObama, from the South Side of Chicago to the White House. Our forever First Lady is the true definition of a 'Phenomenal Woman.' She walked into our lives in 2008 and has shown the world the true meaning of love, dedication, family, education, and healthy living. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ No matter the occasion or event, our First Lady was sure to take over with her elegant and classy sense of style. She was featured in Essence Magazine as one of the ‘World’s Most Inspiring Women’ and appeared on the cover of Vogue and made the Vanity Fair best-dressed list two years in a row. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As our First Lady of the United States, she was not afraid to address the issues at stake. Every speech that she has given has left us with the hope of progress. In her final speech as our FLOTUS, she stated, “Being your First Lady has been the greatest honor of my life and hope I’ve made you proud”..........to read the rest log on to BallerAlert.com (clickable link on profile)
    

        
        
        
        
        
        
        
        
    

    

        

            
            

                
                
                    Chicago, Children, and Family: Ballerific Woman: Michelle Obama,
 From The South Side Of Chicago To
 The White House
 @balleralert
 Read More: www.balleralert.com
Ballerific Woman: Michelle Obama, From The South Side Of Chicago To The White House -blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ In a perfect world, men and women would receive equal pay. African American women would be presented the same opportunities as their white counterparts. Rejection would be based on qualifications rather than race. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Unfortunately, this world is far from perfect, however, there are people, more specifically women, who have dedicated their time, money and education to make a positive change. They’ve used their experiences and their encounters with injustices to fight and-or create more opportunities for their children and their children’s children, in an effort to make the world a better place. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ They've put our pain and problems on their backs and created space for change, new opportunities for our brothers and sisters to excel and succeed in a world that is designed against us. This is BlackExcellence. These are BallerificWomen. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ One of those special individuals is MichelleObama, from the South Side of Chicago to the White House. Our forever First Lady is the true definition of a 'Phenomenal Woman.' She walked into our lives in 2008 and has shown the world the true meaning of love, dedication, family, education, and healthy living. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ No matter the occasion or event, our First Lady was sure to take over with her elegant and classy sense of style. She was featured in Essence Magazine as one of the ‘World’s Most Inspiring Women’ and appeared on the cover of Vogue and made the Vanity Fair best-dressed list two years in a row. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ As our First Lady of the United States, she was not afraid to address the issues at stake. Every speech that she has given has left us with the hope of progress. In her final speech as our FLOTUS, she stated, “Being your First Lady has been the greatest honor of my life and hope I’ve made you proud”..........to read the rest log on to BallerAlert.com (clickable link on profile)
                    
                
            

            
            
Ballerific Woman: Michelle Obama, From The South Side Of Chicago To The White House -blogged by @peachkyss ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ In a perfect worl...

            
            
        

    



            

        

        
        
        
        

            

                




    Community, Lenny, and Lenny Kravitz:  #BAGreekLove. Happy Founder's Day
 Alpha Kappa Alpha Sorority, Inc.
 @balleralert
BAGreekLove: Happy Founder’s Day Alpha Kappa Alpha Sorority, Inc ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about your culture. It wasn’t until the 1830’s that African Americans were even able to receive higher education. That was just the beginning. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ At an HBCU there are many opportunities for students to learn the true meaning of brotherhood and sisterhood. From the marching bands and the dancers, and of course to the nine historically Black Greek Letter Organizations(BGLOs) also referred to as the “divine nine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ To continue to show our love and appreciation for HBCUs, we would like to highlight the “divine nine” at different HBCUs to showcase community involvement as well as the creative steps and strolls. If you would like to show what your organization is doing at your HBCU, please DM @peachkyss or email at peachkyss@balleralert.com ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The sorority was founded on January 15, 1908, at the historically black Howard University in Washington, D.C., by a group of sixteen students led by Ethel Hedgeman Lyle. Forming a sorority broke barriers for African-American women in areas where they had little power or authority, due to a lack of opportunities for minorities and women in the early 20th century. Alpha Kappa Alpha was incorporated on January 29, 1913. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Some well known Alpha Kappa Alpha’s feature PhyliciaRashad, LorettaDevine, RoxieRoker (mother of Lenny Kravitz), MonyettaShaw, ShamariDeVoe (R&B Group Blaque), and StarJones. Honorary members include AliciaKeys, MayaAngelou, GladysKnight, CorrettaScottKing, and more. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Founder’s Day!
    

        
        
        
        
        
        
        
        
    

    

        

            
            

                
                
                    Community, Lenny, and Lenny Kravitz:  #BAGreekLove. Happy Founder's Day
 Alpha Kappa Alpha Sorority, Inc.
 @balleralert
BAGreekLove: Happy Founder’s Day Alpha Kappa Alpha Sorority, Inc ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about your culture. It wasn’t until the 1830’s that African Americans were even able to receive higher education. That was just the beginning. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ At an HBCU there are many opportunities for students to learn the true meaning of brotherhood and sisterhood. From the marching bands and the dancers, and of course to the nine historically Black Greek Letter Organizations(BGLOs) also referred to as the “divine nine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ To continue to show our love and appreciation for HBCUs, we would like to highlight the “divine nine” at different HBCUs to showcase community involvement as well as the creative steps and strolls. If you would like to show what your organization is doing at your HBCU, please DM @peachkyss or email at peachkyss@balleralert.com ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ The sorority was founded on January 15, 1908, at the historically black Howard University in Washington, D.C., by a group of sixteen students led by Ethel Hedgeman Lyle. Forming a sorority broke barriers for African-American women in areas where they had little power or authority, due to a lack of opportunities for minorities and women in the early 20th century. Alpha Kappa Alpha was incorporated on January 29, 1913. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Some well known Alpha Kappa Alpha’s feature PhyliciaRashad, LorettaDevine, RoxieRoker (mother of Lenny Kravitz), MonyettaShaw, ShamariDeVoe (R&B Group Blaque), and StarJones. Honorary members include AliciaKeys, MayaAngelou, GladysKnight, CorrettaScottKing, and more. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Founder’s Day!
                    
                    

                    
                
            

            
            
BAGreekLove: Happy Founder’s Day Alpha Kappa Alpha Sorority, Inc ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about ...

            
            
        

    



            

        

        
        
        
        

            

                



            

        

        
        
        
        

            

                




    Community, Love, and Memes:  #BAGreekLove: Happy Founder's Day
 Delta Sigma Theta Sorority, Inc
 @balleralert
BAGreekLove: Happy Founder’s Day Delta Sigma Theta (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about your culture. It wasn’t until the 1830’s that African Americans were even able to receive higher education. That was just the beginning. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ At an HBCU there are many opportunities for students to learn the true meaning of brotherhood and sisterhood. From the marching bands and the dancers, to the nine historically Black Greek Letter Organizations(BGLOs) also referred to as the “divine nine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ To continue to show our love and appreciation for HBCUs, we would like to highlight the “divine nine” at different HBCUs to showcase community involvement as well as the creative steps and strolls. If you would like to show what your organization is doing at your HBCU, please DM @peachkyss or email at peachkyss@balleralert.com ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Delta Sigma Theta was founded on January 13, 1913 by 22 collegiate women at Howard University. The ladies used their strength to promote academic excellence and assistance to those in need. In March of 1913, the Founders of Delta Sigma Theta Sorority, Inc. participated in the Women's Suffrage March in Washington, D.C. Delta Sigma Theta Sorority, Inc. was incorporated in 1930. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Some well known Delta Sigma Theta members are KeshiaKnightPulliam, MaraBrockAkil, KymWhitley, ShirleyChisholm, CicelyTyson, ArethaFranklin, NatalieCole, AngelaBassett, and so many more. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Founder’s Day!
    

        
        
        
        
        
        
        
        
    

    

        

            
            

                
                
                    Community, Love, and Memes:  #BAGreekLove: Happy Founder's Day
 Delta Sigma Theta Sorority, Inc
 @balleralert
BAGreekLove: Happy Founder’s Day Delta Sigma Theta (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about your culture. It wasn’t until the 1830’s that African Americans were even able to receive higher education. That was just the beginning. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ At an HBCU there are many opportunities for students to learn the true meaning of brotherhood and sisterhood. From the marching bands and the dancers, to the nine historically Black Greek Letter Organizations(BGLOs) also referred to as the “divine nine.” ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ To continue to show our love and appreciation for HBCUs, we would like to highlight the “divine nine” at different HBCUs to showcase community involvement as well as the creative steps and strolls. If you would like to show what your organization is doing at your HBCU, please DM @peachkyss or email at peachkyss@balleralert.com ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Delta Sigma Theta was founded on January 13, 1913 by 22 collegiate women at Howard University. The ladies used their strength to promote academic excellence and assistance to those in need. In March of 1913, the Founders of Delta Sigma Theta Sorority, Inc. participated in the Women's Suffrage March in Washington, D.C. Delta Sigma Theta Sorority, Inc. was incorporated in 1930. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Some well known Delta Sigma Theta members are KeshiaKnightPulliam, MaraBrockAkil, KymWhitley, ShirleyChisholm, CicelyTyson, ArethaFranklin, NatalieCole, AngelaBassett, and so many more. ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ Happy Founder’s Day!
                    
                    

                    
                
            

            
            
BAGreekLove: Happy Founder’s Day Delta Sigma Theta (swipe) ⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀ There's nothing like attending an HBCU to learn more about your c...