Phones
Phones

Phones

What To Do
What To Do

What To Do

When Your
When Your

When Your

Proofs
Proofs

Proofs

Dont Know
Dont Know

Dont Know

Meme Smile
Meme Smile

Meme Smile

Publicated
Publicated

Publicated

Minionator
Minionator

Minionator

Fluffiness
Fluffiness

Fluffiness

So Wrong
So Wrong

So Wrong

🔥 | Latest

Basketball, Facts, and Friday: New Report Shows Trump Had Nothing to Do With Getting UCLA Basketball Players Out Of China After Shoplifting Incident; Lavar Ball Tells Trump: "Know Your Facts" @balleralert New Report Shows Trump Had Nothing to Do With Getting UCLA Basketball Players Out Of China After Shoplifting Incident; Lavar Ball Tells Trump: “Know Your Facts” - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ A new report shows Trump actually didn’t play a role in helping LaVarBall’s son get out of China after his shoplifting incident. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ In November 2017, Ball’s son LiAngelo was arrested in China after him and some of his UCLA teammates were caught shoplifting in several stores. On Nov. 15, the team returned home in what Trump said was all thanks to him. But Ball denied his assistance and refused to thank him. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ This Friday, a new SBNation report showed everything was already taken care of before Trump allegedly got involved. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ “The situation was already resolved by the time we heard about Trump’s involvement,” one team source said. “That’s not to take away from the fact that he got involved, but the players already had their passports back and their flights booked to go home Tuesday night when Gen. Kelly called the players.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Now, Ball is literally having a ball in his tweets mocking 45 saying, “Thank you for what again?" and adding knowyourfacts stayinyolane.
Basketball, Facts, and Friday: New Report Shows Trump Had Nothing to
 Do With Getting UCLA Basketball Players
 Out Of China After Shoplifting Incident;
 Lavar Ball Tells Trump: "Know Your Facts"
 @balleralert
New Report Shows Trump Had Nothing to Do With Getting UCLA Basketball Players Out Of China After Shoplifting Incident; Lavar Ball Tells Trump: “Know Your Facts” - Blogged by: @RaquelHarrisTV ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ A new report shows Trump actually didn’t play a role in helping LaVarBall’s son get out of China after his shoplifting incident. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ In November 2017, Ball’s son LiAngelo was arrested in China after him and some of his UCLA teammates were caught shoplifting in several stores. On Nov. 15, the team returned home in what Trump said was all thanks to him. But Ball denied his assistance and refused to thank him. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ This Friday, a new SBNation report showed everything was already taken care of before Trump allegedly got involved. ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ “The situation was already resolved by the time we heard about Trump’s involvement,” one team source said. “That’s not to take away from the fact that he got involved, but the players already had their passports back and their flights booked to go home Tuesday night when Gen. Kelly called the players.” ⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠀⠀ Now, Ball is literally having a ball in his tweets mocking 45 saying, “Thank you for what again?" and adding knowyourfacts stayinyolane.

New Report Shows Trump Had Nothing to Do With Getting UCLA Basketball Players Out Of China After Shoplifting Incident; Lavar Ball Tells Trum...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

America, Beautiful, and Blood Moon: SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East and eastern Russia), Australia, or New Zealand, you might be in for a lunar treat Jan 31st! But before we tell you how early you might have to wake up to see this, @science.sam explains what a Super Blue Blood Moon is below: . A SuperBlueBloodMoon is the combination of 3 different lunar events that RARELY coincide. . A SUPER moon is when a full moon occurs when the moon is at the closest point in its elliptical orbit to the Earth, called the perigee. Though it’s hard to distinguish with the naked eye, the moon appears about 14% brighter than usual. . A BLUE moon refers to the 2nd full moon in a month, and doesn’t really have anything to do with colour. While the phrase, “once in a blue moon” is used to describe something that’s rare, blue moons actually occur about once every 2.7 years (there will be another blue moon in March, but it won’t be fully eclipsed)! . A BLOOD moon happens when the moon is in full eclipse - meaning that the Earth is blocking direct light from the sun from getting to the moon. Because of the lack of direct sunshine on the moon, the only light hitting it is refracted through the earth’s shadow, giving it the reddish look we also see at sunset. Due to the tilt of the moon’s orbit, not every full moon results in a total eclipse, though there are 2-5 lunar eclipses a year (though not always where you can see em). . The exciting thing about the SuperBlueBloodMoon is that all 3 of these things are happening at once! South America, Asia, and Australia got treated to this back in 1982, and the last time North America experienced this phenomenon was 1866. . The eclipse (peak awesomeness) will happen at 1:30pm UTC, meaning those in Asia + Oceania will be able to see it in the evening of Jan 31st, and those in western North America before dawn. . Regardless of rarity, it’ll be a gorgeous opportunity to gaze up, and even more beautiful if viewed through binoculars (a lunar eclipse is less dangerous to your eyes than a solar eclipse). . Tag a buddy you want to watch this with! . (image credit: @NASA)
America, Beautiful, and Blood Moon: SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East and eastern Russia), Australia, or New Zealand, you might be in for a lunar treat Jan 31st! But before we tell you how early you might have to wake up to see this, @science.sam explains what a Super Blue Blood Moon is below: . A SuperBlueBloodMoon is the combination of 3 different lunar events that RARELY coincide. . A SUPER moon is when a full moon occurs when the moon is at the closest point in its elliptical orbit to the Earth, called the perigee. Though it’s hard to distinguish with the naked eye, the moon appears about 14% brighter than usual. . A BLUE moon refers to the 2nd full moon in a month, and doesn’t really have anything to do with colour. While the phrase, “once in a blue moon” is used to describe something that’s rare, blue moons actually occur about once every 2.7 years (there will be another blue moon in March, but it won’t be fully eclipsed)! . A BLOOD moon happens when the moon is in full eclipse - meaning that the Earth is blocking direct light from the sun from getting to the moon. Because of the lack of direct sunshine on the moon, the only light hitting it is refracted through the earth’s shadow, giving it the reddish look we also see at sunset. Due to the tilt of the moon’s orbit, not every full moon results in a total eclipse, though there are 2-5 lunar eclipses a year (though not always where you can see em). . The exciting thing about the SuperBlueBloodMoon is that all 3 of these things are happening at once! South America, Asia, and Australia got treated to this back in 1982, and the last time North America experienced this phenomenon was 1866. . The eclipse (peak awesomeness) will happen at 1:30pm UTC, meaning those in Asia + Oceania will be able to see it in the evening of Jan 31st, and those in western North America before dawn. . Regardless of rarity, it’ll be a gorgeous opportunity to gaze up, and even more beautiful if viewed through binoculars (a lunar eclipse is less dangerous to your eyes than a solar eclipse). . Tag a buddy you want to watch this with! . (image credit: @NASA)

SUPER BLUE BLOOD MOON JANUARY 31st!!! . Have you heard?!? If you live on the western coast of North America, Asia (including the Middle East...

Hoes, Life, and Memes: ONE GOOD GIRL IS WORTH A THOUSAND HOES When people ask me about the most important factor for achieving financial success, my response usually takes them by surprise. Idk, maybe they expect me to say that what’s most important for your financial freedom is living within your means, investing early, or creating a financial plan. While those are important, in my opinion, nothing is more essential to your financial success than the person you share your life with. - (I’m not gonna be Hitch for you but keep reading) - So, what should you look for in a woman? Here’s basic set of character traits which will also be good for your financial life together. 😉 ✔️High self-esteem. Having self-esteem means that you take pride and value yourself without being arrogant. You don’t let other people mistreat you or take you for granted. ✔️Responsibility. Being responsible is taking care of yourself without relying on other people to remind you when to be somewhere or what to do. Responsible people know they’re in charge of their lives and get things done on time, like showing up for work, paying bills, and managing finances. ✔️Openness. Openness is a trait that’s similar to honesty, but has more to do with emotional intelligence. An open person is aware of his or her feelings, can express them, and wants to communicate in order to keep an emotional connection. - To sum up, high self-esteem, responsibility, openness, are my top 5 recommended traits to look for when you’re choosing a life partner. Of course, there are many more traits that many of us want such as intelligence, honesty. sense of humor, positive attitude, common interests, and similar backgrounds. - Have you found the one? 😉 Comment below! - theone perfect life millionairementor
Hoes, Life, and Memes: ONE GOOD GIRL IS
 WORTH A THOUSAND HOES
When people ask me about the most important factor for achieving financial success, my response usually takes them by surprise. Idk, maybe they expect me to say that what’s most important for your financial freedom is living within your means, investing early, or creating a financial plan. While those are important, in my opinion, nothing is more essential to your financial success than the person you share your life with. - (I’m not gonna be Hitch for you but keep reading) - So, what should you look for in a woman? Here’s basic set of character traits which will also be good for your financial life together. 😉 ✔️High self-esteem. Having self-esteem means that you take pride and value yourself without being arrogant. You don’t let other people mistreat you or take you for granted. ✔️Responsibility. Being responsible is taking care of yourself without relying on other people to remind you when to be somewhere or what to do. Responsible people know they’re in charge of their lives and get things done on time, like showing up for work, paying bills, and managing finances. ✔️Openness. Openness is a trait that’s similar to honesty, but has more to do with emotional intelligence. An open person is aware of his or her feelings, can express them, and wants to communicate in order to keep an emotional connection. - To sum up, high self-esteem, responsibility, openness, are my top 5 recommended traits to look for when you’re choosing a life partner. Of course, there are many more traits that many of us want such as intelligence, honesty. sense of humor, positive attitude, common interests, and similar backgrounds. - Have you found the one? 😉 Comment below! - theone perfect life millionairementor

When people ask me about the most important factor for achieving financial success, my response usually takes them by surprise. Idk, maybe t...