ifs
ifs

ifs

yours
yours

yours

comming
comming

comming

played
played

played

understandable
understandable

understandable

starve
starve

starve

drinking and driving
drinking and driving

drinking and driving

thing
thing

thing

why
why

why

🤖
🤖

🤖

🔥 | Latest

Bad, Family, and Friends: MILLIOHATRE MENTOR MAKEF CKING MISTAKES. Did you know its completely OK to make mistakes? Read on… ✔️We learn from mistakes! The best way to learn is to experience life for ourselves and learn the natural consequences of our actions. This does not mean that we have to try everything to know better. After we develop critical-thinking skills, we can also observe the mistakes of others and see where their choices lead or anticipate possible outcomes. This can help us avoid major mistakes that can change the course of our life. ✔️When we know better, we do better. Making a mistake is not the end of the world. It just means that we can correct ourselves and start again. If you've hurt someone, apologize. If you've done something wrong, make it right. ✔️Your best is good enough. Forget trying to be perfect, and just do your best. Mistakes will still happen, but that is normal. Stop comparing yourself to the people at the gym, neighbors, friends, family members or co-workers. You may think they are perfect, but everyone has their flaws, regardless of how good they are at hiding them. ✔️Don't be hard on yourself for making mistakes. Focus on what you have learned and pat yourself on the back for correcting the wrong. Leave the past in the past and look toward to making better choices in the future. - Mistakes are essential for our growth and understanding of ourselves and the world. Whether it's our mistake or an error of a family member or friend, we need to realize that it does not make us, or them, bad people. We can learn, grow, change and start making better choices. Wrongs can be made right, and we can become our best self as we learn to be patient with ourselves. Remember, everyone makes mistakes, and it's normal. We can change. We can learn and make better choices! - What do you guys think? Leave a comment below! - mistakes success millionairementor
Bad, Family, and Friends: MILLIOHATRE MENTOR
 MAKEF CKING
 MISTAKES.
Did you know its completely OK to make mistakes? Read on… ✔️We learn from mistakes! The best way to learn is to experience life for ourselves and learn the natural consequences of our actions. This does not mean that we have to try everything to know better. After we develop critical-thinking skills, we can also observe the mistakes of others and see where their choices lead or anticipate possible outcomes. This can help us avoid major mistakes that can change the course of our life. ✔️When we know better, we do better. Making a mistake is not the end of the world. It just means that we can correct ourselves and start again. If you've hurt someone, apologize. If you've done something wrong, make it right. ✔️Your best is good enough. Forget trying to be perfect, and just do your best. Mistakes will still happen, but that is normal. Stop comparing yourself to the people at the gym, neighbors, friends, family members or co-workers. You may think they are perfect, but everyone has their flaws, regardless of how good they are at hiding them. ✔️Don't be hard on yourself for making mistakes. Focus on what you have learned and pat yourself on the back for correcting the wrong. Leave the past in the past and look toward to making better choices in the future. - Mistakes are essential for our growth and understanding of ourselves and the world. Whether it's our mistake or an error of a family member or friend, we need to realize that it does not make us, or them, bad people. We can learn, grow, change and start making better choices. Wrongs can be made right, and we can become our best self as we learn to be patient with ourselves. Remember, everyone makes mistakes, and it's normal. We can change. We can learn and make better choices! - What do you guys think? Leave a comment below! - mistakes success millionairementor

Did you know its completely OK to make mistakes? Read on… ✔️We learn from mistakes! The best way to learn is to experience life for ourselve...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and I’m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells don’t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But here’s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesn’t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at “sequencing DNA” letter by letter, it is possible for you to learn how your DNA may differ from the person’s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we haven’t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, it’s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...

America, Bodies , and Food: GRIND NOW SHINE LATER Check out how @davis_008 turned his passion into a REAL business👇 We all have passions. For some, it's a sport or activity. For others, it's a topic or a “thing.” Many of us dream about turning our passions into business ideas, but most of us have no idea how to even get started! - Davis is a young entrepreneur born and raised in Peru (South America) who at the age of 15 lost his father due to a disease and with no other options his mother made the decision to immigrate to the United States looking for a better future. - It was surely not easy to start from zero and to adapt to a completely new culture or language, but growing up with two hard-working parents who taught him great values and preservation, Davis never gave up and was ready to overcome any challenge. - Losing his father due to a disease, awakened the interest to find different healthy foods, methods and resources to heal and make our bodies perform in an optimum way, an interest which became a PASSION for fitness, nutrition and the practice of healthy habits. - Understanding the importance and the power of food, Davis was aware of the AMAZING resources his native country (Peru) had to offer to the world 🌎 and looking for ways to make it available to everyone, he created his first supplement company: Apu Nutrition INC @apunutrition 🍃 And as a first supplement he choose a superfood called “Maca” an amazing root with tons of great benefits for our bodies. Davis spent MONTHS on research and development, flew multiple times to Peru looking for the best quality and resources to provide his customers with a PREMIUM and exclusive blend. I personally take it almost every day and love it! - Be sure to drop some love on his new business page @apunutrition - Follow the KING of MACA @davis_008 and join him on this amazing journey! (He’s just getting started 🔥) 👉 @davis_008
America, Bodies , and Food: GRIND NOW
 SHINE LATER
Check out how @davis_008 turned his passion into a REAL business👇 We all have passions. For some, it's a sport or activity. For others, it's a topic or a “thing.” Many of us dream about turning our passions into business ideas, but most of us have no idea how to even get started! - Davis is a young entrepreneur born and raised in Peru (South America) who at the age of 15 lost his father due to a disease and with no other options his mother made the decision to immigrate to the United States looking for a better future. - It was surely not easy to start from zero and to adapt to a completely new culture or language, but growing up with two hard-working parents who taught him great values and preservation, Davis never gave up and was ready to overcome any challenge. - Losing his father due to a disease, awakened the interest to find different healthy foods, methods and resources to heal and make our bodies perform in an optimum way, an interest which became a PASSION for fitness, nutrition and the practice of healthy habits. - Understanding the importance and the power of food, Davis was aware of the AMAZING resources his native country (Peru) had to offer to the world 🌎 and looking for ways to make it available to everyone, he created his first supplement company: Apu Nutrition INC @apunutrition 🍃 And as a first supplement he choose a superfood called “Maca” an amazing root with tons of great benefits for our bodies. Davis spent MONTHS on research and development, flew multiple times to Peru looking for the best quality and resources to provide his customers with a PREMIUM and exclusive blend. I personally take it almost every day and love it! - Be sure to drop some love on his new business page @apunutrition - Follow the KING of MACA @davis_008 and join him on this amazing journey! (He’s just getting started 🔥) 👉 @davis_008

Check out how @davis_008 turned his passion into a REAL business👇 We all have passions. For some, it's a sport or activity. For others, it's...